Transcript: Mouse XM_011239346.1

PREDICTED: Mus musculus N-ethylmaleimide sensitive fusion protein attachment protein beta (Napb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Napb (17957)
Length:
4049
CDS:
24..638

Additional Resources:

NCBI RefSeq record:
XM_011239346.1
NBCI Gene record:
Napb (17957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313043 ACTTAGTTTAGGGTGCTTATT pLKO_005 1017 3UTR 100% 13.200 18.480 N Napb n/a
2 TRCN0000313042 ACGGACTCCAGAGAATGTAAA pLKO_005 447 CDS 100% 13.200 10.560 N Napb n/a
3 TRCN0000111637 CGGACTCCAGAGAATGTAAAT pLKO.1 448 CDS 100% 13.200 10.560 N Napb n/a
4 TRCN0000379757 TGAGAATCGGAGGCTTCTATT pLKO_005 763 3UTR 100% 13.200 10.560 N Napb n/a
5 TRCN0000111636 GCTTCGTATCAAGAAGTCCAT pLKO.1 581 CDS 100% 2.640 2.112 N Napb n/a
6 TRCN0000382175 GTGAAGGAGTTTGACTCAATA pLKO_005 528 CDS 100% 13.200 9.240 N Napb n/a
7 TRCN0000375832 TAGCTACTTTGAAGGTGTTAG pLKO_005 1083 3UTR 100% 10.800 7.560 N Napb n/a
8 TRCN0000313041 TCACCATTGCCGAGATCTATG pLKO_005 115 CDS 100% 10.800 7.560 N Napb n/a
9 TRCN0000111639 GCTGGAAATGCGTACAAGAAA pLKO.1 50 CDS 100% 5.625 3.938 N Napb n/a
10 TRCN0000111638 CGTGGACATTGAGAAGGCTAT pLKO.1 146 CDS 100% 4.050 2.835 N Napb n/a
11 TRCN0000363709 CGTGGACATTGAGAAGGCTAT pLKO_005 146 CDS 100% 4.050 2.835 N Napb n/a
12 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 3243 3UTR 100% 4.950 2.475 Y HMBOX1 n/a
13 TRCN0000111635 CCAGGGTTAAAGTCCCAGAAT pLKO.1 2594 3UTR 100% 4.950 2.475 Y Napb n/a
14 TRCN0000229280 ATGAACAATCTGCTGATTATT pLKO_005 175 CDS 100% 15.000 10.500 N NAPB n/a
15 TRCN0000065199 GCAAAGGATTACTTCTTCAAA pLKO.1 345 CDS 100% 5.625 3.938 N NAPB n/a
16 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1258 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08813 pDONR223 100% 62% 62% None (many diffs) n/a
2 ccsbBroad304_08813 pLX_304 0% 62% 62% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000466078 GCACGATCACTACGTGCCGCCTTG pLX_317 46.7% 62% 62% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV