Construct: ORF TRCN0000466171
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002894.1_s317c1
- Derived from:
- ccsbBroadEn_05938
- DNA Barcode:
- CGATGTGCTGGCTCAGCATAACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CASQ2 (845)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466171
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 845 | CASQ2 | calsequestrin 2 | NM_001232.3 | 99.9% | 100% | 1185C>T |
| 2 | mouse | 12373 | Casq2 | calsequestrin 2 | NM_009814.4 | 83.4% | 86.7% | (many diffs) |
| 3 | mouse | 12373 | Casq2 | calsequestrin 2 | NM_001355663.1 | 82.8% | 86.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1263
- ORF length:
- 1197
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gagaactcac ttgtttattg tggggattta ttttctgtcc tcttgcaggg 121 cagaagaggg gcttaatttc cccacatatg atgggaagga ccgagtggta agtctttccg 181 agaagaactt caagcaggtt ttaaagaaat atgacttgct ttgcctctac taccatgagc 241 cggtgtcttc agataaggtc acgcaaaaac agttccaact gaaagaaatc gtgcttgagc 301 ttgtggccca ggtccttgaa cataaagcta taggctttgt gatggtggat gccaagaaag 361 aagccaagct tgccaagaaa ctgggttttg atgaagaagg aagcctgtat attcttaagg 421 gtgatcgcac aatagagttt gatggcgagt ttgcagctga tgtcttggtg gagttcctct 481 tggatctaat tgaagaccca gtggagatca tcagcagcaa actggaagtc caagccttcg 541 aacgcattga agactacatc aaactcattg gctttttcaa gagtgaggac tcagaatact 601 acaaggcttt tgaagaagca gctgaacact tccagcctta catcaaattc tttgccacct 661 ttgacaaagg ggttgcaaag aaattatctt tgaagatgaa tgaggttgac ttctatgagc 721 catttatgga tgagcccatt gccatcccca acaaacctta cacagaagag gagctggtgg 781 agtttgtgaa ggaacaccaa agacccactc tacgtcgcct gcgcccagaa gaaatgtttg 841 aaacatggga agatgatttg aatgggatcc acattgtggc cttTGCAGAG AAGAGTGATC 901 CAGATGGCTA CGAATTCCTG GAGATCCTGA AACAGGTTGC CCGGGACAAT ACTGACAACC 961 CCGATCTGAG CATCCTGTGG ATCGACCCGG ACGACTTTCC TCTGCTCGTT GCCTACTGGG 1021 AGAAGACTTT CAAGATTGAC CTATTCAGGC CACAGATTGG GGTGGTGAAT GTCACAGATG 1081 CTGACAGTGT CTGGATGGAG ATTCCAGATG ATGACGATCT TCCAACTGCT GAGGAGCTGG 1141 AGGACTGGAT TGAGGATGTG CTTTCTGGAA AGATAAACAC TGAAGATGAT GATGAAGATG 1201 ATGATGATGA TGATAATTCT GATGAAGAGG ATAATGATGA CAGTGATGAT GATGATGATG 1261 AATACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1321 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1381 GGCTTTATAT ATCTTGTGGA AAGGACGACG ATGTGCTGGC TCAGCATAAC TCACGCGTTA 1441 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt