Transcript: Mouse NM_001355663.1

Mus musculus calsequestrin 2 (Casq2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Mus musculus (mouse)
Gene:
Casq2 (12373)
Length:
2593
CDS:
225..1481

Additional Resources:

NCBI RefSeq record:
NM_001355663.1
NBCI Gene record:
Casq2 (12373)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001355663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114813 CCCAGTGGAGATCGTGAATAA pLKO.1 656 CDS 100% 13.200 10.560 N Casq2 n/a
2 TRCN0000114812 CCCAACGTCATCCCTAACAAA pLKO.1 894 CDS 100% 5.625 4.500 N Casq2 n/a
3 TRCN0000114814 ACTGGATTGAAGATGTGCTTT pLKO.1 1312 CDS 100% 4.950 3.465 N Casq2 n/a
4 TRCN0000114811 CCCTTGTTCTTTGCTAGACAA pLKO.1 1736 3UTR 100% 4.950 3.465 N Casq2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05938 pDONR223 100% 82.8% 86.1% None (many diffs) n/a
2 ccsbBroad304_05938 pLX_304 0% 82.8% 86.1% V5 (many diffs) n/a
3 TRCN0000466171 CGATGTGCTGGCTCAGCATAACTC pLX_317 32% 82.8% 86.1% V5 (many diffs) n/a
Download CSV