Transcript: Human NM_001232.3

Homo sapiens calsequestrin 2 (CASQ2), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CASQ2 (845)
Length:
2716
CDS:
265..1464

Additional Resources:

NCBI RefSeq record:
NM_001232.3
NBCI Gene record:
CASQ2 (845)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437378 GGCCCAGGTCCTTGAACATAA pLKO_005 504 CDS 100% 13.200 10.560 N CASQ2 n/a
2 TRCN0000053934 CGCCCAGAAGAAATGTTTGAA pLKO.1 1021 CDS 100% 5.625 4.500 N CASQ2 n/a
3 TRCN0000053936 GAAGACTACATCAAACTCATT pLKO.1 748 CDS 100% 4.950 3.960 N CASQ2 n/a
4 TRCN0000416679 AGTTCCTCTTGGATCTAATTG pLKO_005 671 CDS 100% 13.200 9.240 N CASQ2 n/a
5 TRCN0000053937 GACTTTCAAGATTGACCTATT pLKO.1 1224 CDS 100% 10.800 7.560 N CASQ2 n/a
6 TRCN0000053933 CCAGCCTTACATCAAATTCTT pLKO.1 831 CDS 100% 5.625 3.938 N CASQ2 n/a
7 TRCN0000053935 GCTTGCCAAGAAACTGGGTTT pLKO.1 567 CDS 100% 4.050 2.835 N CASQ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05938 pDONR223 100% 99.9% 100% None 1185C>T n/a
2 ccsbBroad304_05938 pLX_304 0% 99.9% 100% V5 1185C>T n/a
3 TRCN0000466171 CGATGTGCTGGCTCAGCATAACTC pLX_317 32% 99.9% 100% V5 1185C>T n/a
Download CSV