Construct: ORF TRCN0000466230
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015722.1_s317c1
- Derived from:
- ccsbBroadEn_09561
- DNA Barcode:
- ATAACCAATGATTTCCGACAGATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SRSF12 (135295)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466230
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 135295 | SRSF12 | serine and arginine rich sp... | NM_080743.5 | 99.7% | 99.2% | 188A>G;445C>A |
| 2 | human | 135295 | SRSF12 | serine and arginine rich sp... | XM_017010292.1 | 99.7% | 99.2% | 188A>G;445C>A |
| 3 | human | 135295 | SRSF12 | serine and arginine rich sp... | XM_011535483.2 | 92.7% | 89.8% | (many diffs) |
| 4 | human | 135295 | SRSF12 | serine and arginine rich sp... | XM_006715348.2 | 63.4% | 63.2% | 0_1ins285;160C>A |
| 5 | mouse | 272009 | Srsf12 | serine/arginine-rich splici... | XM_006537958.1 | 85.4% | 88.8% | (many diffs) |
| 6 | mouse | 272009 | Srsf12 | serine/arginine-rich splici... | XM_017320249.1 | 78.9% | 81.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 849
- ORF length:
- 783
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tcgctacacg aggcccccca acacctccct gttcatcagg aacgtcgcgg 121 acgccaccag gcctgaggac ttgcgccgtg agtttggtcg atatggccct atagtagacg 181 tttacattcc acttgacttc tacactcgcc gcccaagagg atttgcttat gttcaatttg 241 aagatgttcg aggtgctgaa gatgctcttt ataacctcaa tagaaagtgg gtatgtggcc 301 gtcagattga aatacagttt gcacaaggtg atcgcaaaac accaggccaa atgaaatcaa 361 aagaacgtca tccttgttct ccaagtgatc acaggagatc aagaagcccc agccaaagaa 421 gaactcgaag tagaagttct tcatggGGAA GAAATAGGAG GCGGTCAGAC AGCCTTAAAG 481 AGTCTCGACA CAGGCGATTT TCTTATAGCA AGTCTAAATC TCGTTCCAAA TCATTACCAA 541 GGCGGTCTAC CTCAGCAAGG CAGTCAAGAA CTCCAAGAAG GAATTTTGGC TCTAGAGGAC 601 GGTCAAGGTC CAAGTCCTTA CAAAAGAGGT CCAAGTCAAT AGGAAAATCA CAGTCAAGTT 661 CACCTCAAAA GCAGACTAGC TCAGGAACAA AATCAAGATC ACATGGAAGA CATTCTGACT 721 CAATAGCAAG ATCCCCGTGT AAATCTCCCA AAGGGTATAC CAATTCTGAA ACTAAAGTAC 781 AAACAGCAAA GCATTCTCAT TTTCGGTCAC ATTCCAGATC TCGAAGTTAT CGTCATAAAA 841 ACAGTTGGTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 901 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGCCC GTAACTTGAA AGTATTTCGA 961 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATAACC AATGATTTCC GACAGATTAC 1021 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt