Transcript: Mouse XM_006537958.1

PREDICTED: Mus musculus serine/arginine-rich splicing factor 12 (Srsf12), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srsf12 (272009)
Length:
2916
CDS:
80..865

Additional Resources:

NCBI RefSeq record:
XM_006537958.1
NBCI Gene record:
Srsf12 (272009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414908 CAGTCTAAATCTCGTTCCAAA pLKO_005 524 CDS 100% 4.950 6.930 N Srsf12 n/a
2 TRCN0000182899 CCAAATAACTTTGTTGGCAAT pLKO.1 2422 3UTR 100% 4.050 5.670 N Srsf12 n/a
3 TRCN0000436298 GAATAGGCCAGAGACTTAAAC pLKO_005 1263 3UTR 100% 13.200 9.240 N Srsf12 n/a
4 TRCN0000423838 GACGACACTGTGACTCCATAG pLKO_005 720 CDS 100% 6.000 4.200 N Srsf12 n/a
5 TRCN0000195858 CAGAGGACGATCAAGATCCAA pLKO.1 607 CDS 100% 3.000 2.100 N Srsf12 n/a
6 TRCN0000183709 GCCAATAATATCCTTTACCAA pLKO.1 1184 3UTR 100% 3.000 2.100 N Srsf12 n/a
7 TRCN0000183248 GCCCTAGCTTTGGTTAATAAA pLKO.1 1001 3UTR 100% 15.000 9.000 N Srsf12 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2306 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09561 pDONR223 100% 85.4% 88.8% None (many diffs) n/a
2 ccsbBroad304_09561 pLX_304 0% 85.4% 88.8% V5 (many diffs) n/a
3 TRCN0000466230 ATAACCAATGATTTCCGACAGATT pLX_317 51.4% 85.4% 88.8% V5 (many diffs) n/a
Download CSV