Transcript: Human XM_006715348.2

PREDICTED: Homo sapiens serine and arginine rich splicing factor 12 (SRSF12), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRSF12 (135295)
Length:
3763
CDS:
642..1142

Additional Resources:

NCBI RefSeq record:
XM_006715348.2
NBCI Gene record:
SRSF12 (135295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417184 ATCTCGAAGTTATCGTCATAA pLKO_005 1109 CDS 100% 13.200 18.480 N SRSF12 n/a
2 TRCN0000432032 ATGCGAGTTGATATTAGTTAC pLKO_005 1232 3UTR 100% 10.800 15.120 N SRSF12 n/a
3 TRCN0000157878 CGTGTAAATCTCCCAAAGGGT pLKO.1 1027 CDS 100% 0.750 0.600 N SRSF12 n/a
4 TRCN0000423934 ATTCTACTTGCATAGTATTAG pLKO_005 1438 3UTR 100% 13.200 9.240 N SRSF12 n/a
5 TRCN0000156842 GCAGACTAGCTCAGGAACAAA pLKO.1 962 CDS 100% 5.625 3.938 N SRSF12 n/a
6 TRCN0000155421 CACAGTCAAGTTCACCTCAAA pLKO.1 940 CDS 100% 4.950 3.465 N SRSF12 n/a
7 TRCN0000414908 CAGTCTAAATCTCGTTCCAAA pLKO_005 801 CDS 100% 4.950 3.465 N Srsf12 n/a
8 TRCN0000155284 GAGGTCCAAGTCAATAGGAAA pLKO.1 917 CDS 100% 4.950 3.465 N SRSF12 n/a
9 TRCN0000158202 CCAGCCAAAGAAGAACTCGAA pLKO.1 700 CDS 100% 2.640 1.848 N SRSF12 n/a
10 TRCN0000151194 GAACTCGAAGTAGAAGTTCTT pLKO.1 712 CDS 100% 0.495 0.347 N SRSF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09561 pDONR223 100% 63.4% 63.2% None 0_1ins285;160C>A n/a
2 ccsbBroad304_09561 pLX_304 0% 63.4% 63.2% V5 0_1ins285;160C>A n/a
3 TRCN0000466230 ATAACCAATGATTTCCGACAGATT pLX_317 51.4% 63.4% 63.2% V5 0_1ins285;160C>A n/a
Download CSV