Construct: ORF TRCN0000466461
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000331.1_s317c1
- Derived from:
- ccsbBroadEn_14212
- DNA Barcode:
- ATGATATAAATTGCTGTAGTTGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GSDMB (55876)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466461
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55876 | GSDMB | gasdermin B | NM_001165959.1 | 98.7% | 98% | (many diffs) |
| 2 | human | 55876 | GSDMB | gasdermin B | NM_001165958.1 | 96.5% | 95.9% | (many diffs) |
| 3 | human | 55876 | GSDMB | gasdermin B | NM_001042471.1 | 95.9% | 95.3% | (many diffs) |
| 4 | human | 55876 | GSDMB | gasdermin B | NM_001369402.1 | 95.9% | 95.3% | (many diffs) |
| 5 | human | 55876 | GSDMB | gasdermin B | NM_018530.2 | 95.5% | 94.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1299
- ORF length:
- 1233
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt cagcgtattt gaggatatca caagaattgt agttaaggag atggatgctg 121 gaggggatat gattgccgtt agaagccttg ttgatgctga tagattccgc tgcttccatc 181 tggtggggga gaagagaact ttctttggat gccggcacta cacaacaggc ctcaccctga 241 tggacattct ggacacagat ggggacaagt ggttagatga actggattct gggctccaag 301 gtcaaaaggc tgagtttcaa attctggata atgtagactc aacgggagag ttgatagtga 361 gattacccaa agaaataaca atttcaggca gtttccaggg cttccaccat cagaaaatca 421 agatatcgga gaaccggata tcccagcagt atctggctac ccttgaaaac aggaagctga 481 agagggaact acccttttca ttccgatcaa ttaatacgag agaaaacctg tatctggtga 541 cagaaactct ggagacggta aaggaggaaa ccctgaaaag cgaccggcaa tataaatttt 601 ggagccagat ctctcagggc catctcagct ataaacacaa gggccaaagg gaagtgacca 661 tccccccaaa tcgggtcctg agctatcgag taaagcagct tgtcttcccc aacaaggaga 721 cgatgagtgc tggtttggat attcatttca ggggcaaaac aaaatccttt ccagaaggaa 781 agtctttggg ttcggaggat tccagaaaca tgaaggagaa gttggaggac atggagagtg 841 tcctcaagga ccTGACAGAG GAGAAGAGAA AAGATGTGCT AAACTCCCTC GCTAAGTGCC 901 TCGGCAAGGA GGATATTCGG CAGGATCTAG AGCAAAGAGT ATCTGAGGTC CTGATTTCCA 961 GGGAGCTACA CATGGAGGAC TCAGACAAGC CTCTCCTAAG CAGCCTTTTT AATGCTGCTG 1021 GGGTCTTGGT AGAAGCGCGT GCAAAAGCCA TTCTGGACTT CCTGGATGCC CTCCTAGAGC 1081 TGTCTGAAGA GCAGCAGTTT GTGGCTGAGG CCCTGGAGAA GGGGACCCTT CCTCTGTTGA 1141 AGGACCAGGT GAAATCTGTC ATGGAGCAGA ACTGGGATGA GCTGGCCAGC AGTCCTCCTG 1201 ACATGGACTA TGACCCTGAG GCACGAATTC TCTGTGCGCT GTATGTTGTT GTCTCTATCC 1261 TGCTGGAGCT GGCTGAGGGG CCTACCTCTG TCTCTTCCTA CCCAACTTTC TTGTACAAAG 1321 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1381 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1441 ACGAATGATA TAAATTGCTG TAGTTGTTAC GCGTTAAGTC gacaatcaac ctctggatta 1501 caaaatttgt gaaagatt