Transcript: Human NM_018530.2

Homo sapiens gasdermin B (GSDMB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GSDMB (55876)
Length:
1646
CDS:
225..1409

Additional Resources:

NCBI RefSeq record:
NM_018530.2
NBCI Gene record:
GSDMB (55876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167080 CGATCAATTAATACGAGAGAA pLKO.1 663 CDS 100% 4.950 6.930 N GSDMB n/a
2 TRCN0000168794 GCCTTGTTGATGCTGATAGAT pLKO.1 304 CDS 100% 5.625 3.938 N GSDMB n/a
3 TRCN0000137108 CGGGAGAGTTGATAGTGAGAT pLKO.1 502 CDS 100% 4.950 3.465 N GSDMB n/a
4 TRCN0000137447 GAGGATATTCGGCAGGATCTA pLKO.1 1017 CDS 100% 4.950 3.465 N GSDMB n/a
5 TRCN0000167710 GCTGTATGTTGTTGTCTCTAT pLKO.1 1346 CDS 100% 4.950 3.465 N GSDMB n/a
6 TRCN0000136344 GAAATCTGTCATGGAGCAGAA pLKO.1 1259 CDS 100% 4.050 2.835 N GSDMB n/a
7 TRCN0000136308 GAAGCCTTGTTGATGCTGATA pLKO.1 301 CDS 100% 4.950 2.970 N GSDMB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14212 pDONR223 100% 95.5% 94.8% None (many diffs) n/a
2 ccsbBroad304_14212 pLX_304 0% 95.5% 94.8% V5 (many diffs) n/a
3 TRCN0000466461 ATGATATAAATTGCTGTAGTTGTT pLX_317 36.4% 95.5% 94.8% V5 (many diffs) n/a
Download CSV