Transcript: Human NM_001369402.1

Homo sapiens gasdermin B (GSDMB), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GSDMB (55876)
Length:
1653
CDS:
225..1436

Additional Resources:

NCBI RefSeq record:
NM_001369402.1
NBCI Gene record:
GSDMB (55876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167080 CGATCAATTAATACGAGAGAA pLKO.1 663 CDS 100% 4.950 6.930 N GSDMB n/a
2 TRCN0000168794 GCCTTGTTGATGCTGATAGAT pLKO.1 304 CDS 100% 5.625 3.938 N GSDMB n/a
3 TRCN0000137108 CGGGAGAGTTGATAGTGAGAT pLKO.1 502 CDS 100% 4.950 3.465 N GSDMB n/a
4 TRCN0000137447 GAGGATATTCGGCAGGATCTA pLKO.1 1044 CDS 100% 4.950 3.465 N GSDMB n/a
5 TRCN0000167710 GCTGTATGTTGTTGTCTCTAT pLKO.1 1373 CDS 100% 4.950 3.465 N GSDMB n/a
6 TRCN0000136344 GAAATCTGTCATGGAGCAGAA pLKO.1 1286 CDS 100% 4.050 2.835 N GSDMB n/a
7 TRCN0000136308 GAAGCCTTGTTGATGCTGATA pLKO.1 301 CDS 100% 4.950 2.970 N GSDMB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14212 pDONR223 100% 95.9% 95.3% None (many diffs) n/a
2 ccsbBroad304_14212 pLX_304 0% 95.9% 95.3% V5 (many diffs) n/a
3 TRCN0000466461 ATGATATAAATTGCTGTAGTTGTT pLX_317 36.4% 95.9% 95.3% V5 (many diffs) n/a
Download CSV