Construct: ORF TRCN0000466464
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017669.1_s317c1
- Derived from:
- ccsbBroadEn_02811
- DNA Barcode:
- TGAAACAATCAAACCGGCTCGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RUSC1 (23623)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466464
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NM_001278230.2 | 100% | 100% | |
2 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NM_014328.4 | 100% | 100% | |
3 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | XM_006711257.1 | 100% | 100% | |
4 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NM_001278228.1 | 92.4% | 91.5% | (many diffs) |
5 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NM_001278227.1 | 92.3% | 92.3% | 122_123ins99 |
6 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NM_001105205.1 | 88% | 88% | 1_177del |
7 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NM_001278229.1 | 75.5% | 75.5% | 451_452ins318 |
8 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | XM_017000892.1 | 75.5% | 75.5% | 451_452ins318 |
9 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NM_001105203.2 | 48% | 48% | 1_1407del |
10 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NR_103478.2 | 45.7% | (many diffs) | |
11 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | XM_006711254.2 | 41.6% | 41.6% | 1_1818del |
12 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | XM_017000891.1 | 41.6% | 41.6% | 1_1818del |
13 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | NM_001105204.2 | 36.2% | 36.2% | 1_1407del;1858_1859ins318 |
14 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | XR_921763.2 | 34.7% | 1_1891del;3191_3736del | |
15 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | XM_006711256.2 | 31.4% | 31.4% | 1_1818del;2269_2270ins318 |
16 | human | 23623 | RUSC1 | RUN and SH3 domain containi... | XR_001737085.2 | 26.2% | 1_1891del;2342_2343ins318;2873_3418del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1365
- ORF length:
- 1299
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agaagcccag agtgggactg gtcagctgca ggagcagaag aaaggtcttc 121 tgatagccgt cagcgtctcc gttgataaaa tcatctcgca tttcggggcc gcccggaact 181 tggtgcagaa ggcccagttg ggtgatagcc ggctgagccc ggatgtgggg cacctggtgc 241 tgaccaccct ctgcccggcc ctccacgccc tggtggcgga cgggctgaag cctttccgga 301 aggacctcat caccgggcag cgcaggagca gcccctggag cgtggtggag gcgtcggtga 361 agccaggctc cagcacccgc tcccttggaa ccctgtatag ccaggtcagc cgtctagccc 421 cgctgagcag cagccgtagc cgcttccatg cctttatcct gggcctcctc aacaccaagc 481 agttggagct gtggttttcc agtctccagg aagatgcagg cctgctctcc ctcctgtacc 541 tgccaacagg atttttctcc ctggcccgcg gtggttgtcc ctccctgtcc acagagctgc 601 tgctcctgct gcagccattg tcggtgctca ctttccacct ggacctgctc tttgagcacc 661 accaccacct gcccctgggc ccacctcagg cccctgcccc tccaggccca cctccagctc 721 tgcagcagac tatgcaagcc atgctgcact ttgggggccg gctggcccag agccttcggg 781 ggacttccaa ggaagctgct tcagacccct ctgactctcc aaaccttccc acaccaggga 841 gctggtggga gcagttgacc caggcctccc gggtctatgc ctctgggggc actgagggct 901 ttcctctttc ccgatgggca ccggggcgtc atggGACTGC AGCTGAAGAA GGTGCACAGG 961 AGAGACCCCT GCCCACAGAT GAGATGGCAC CAGGCAGGGG CCTCTGGTTG GGAAGACTAT 1021 TTGGAGTGCC TGGGGGCCCC GCAGAAAATG AGAATGGAGC CCTAAAGTCC AGGAGACCAT 1081 CTAGCTGGCT GCCCCCGACA GTGAGTGTGT TGGCTCTTGT GAAGCGGGGG GCACCTCCCG 1141 AGATGCCTTC TCCTCAGGAG CTTGAGGCCT CAGCACCCAG GATGGTGCAA ACCCATAGGG 1201 CAGTGCGGGC TCTCTGTGAT CACACTGCTG CAAGACCTGA CCAGTTGAGC TTCCGGCGTG 1261 GGGAAGTGCT GCGTGTCATC ACCACAGTGG ATGAGGACTG GCTCCGCTGT GGGCGGGATG 1321 GCATGGAGGG TCTGGTGCCT GTGGGGTATA CCTCCCTTGT TCTGTACCCA ACTTTCTTGT 1381 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1441 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1501 GAAAGGACGA TGAAACAATC AAACCGGCTC GCCAACGCGT TAAGTCgaca atcaacctct 1561 ggattacaaa atttgtgaaa gatt