Transcript: Human XR_001737085.2

PREDICTED: Homo sapiens RUN and SH3 domain containing 1 (RUSC1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUSC1 (23623)
Length:
3418
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737085.2
NBCI Gene record:
RUSC1 (23623)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737085.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439758 CGTCAGCGTCTCCGTTGATAA pLKO_005 1954 3UTR 100% 13.200 18.480 N RUSC1 n/a
2 TRCN0000160233 CACGTCTGTTTCTGCTAATAT pLKO.1 2985 3UTR 100% 15.000 10.500 N RUSC1 n/a
3 TRCN0000428555 CCAAGTTGCCTGTATTGATAA pLKO_005 3286 3UTR 100% 13.200 9.240 N RUSC1 n/a
4 TRCN0000166441 CCCACGTCTGTTTCTGCTAAT pLKO.1 2983 3UTR 100% 10.800 7.560 N RUSC1 n/a
5 TRCN0000161335 GACCTCCTTCTTCATCCATAA pLKO.1 3171 3UTR 100% 10.800 7.560 N RUSC1 n/a
6 TRCN0000161608 GTATACCTCCCTTGTTCTGTA pLKO.1 2854 3UTR 100% 4.950 3.465 N RUSC1 n/a
7 TRCN0000166827 CAGGAGCAGAAGAAAGGTCTT pLKO.1 1925 3UTR 100% 4.050 2.835 N RUSC1 n/a
8 TRCN0000159995 CAGAAGAAAGGTCTTCTGATA pLKO.1 1931 3UTR 100% 0.495 0.347 N RUSC1 n/a
9 TRCN0000161105 GCAGAAGAAAGGTCTTCTGAT pLKO.1 1930 3UTR 100% 0.495 0.347 N RUSC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737085.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02811 pDONR223 100% 26.2% None 1_1891del;2342_2343ins318;2873_3418del n/a
2 ccsbBroad304_02811 pLX_304 0% 26.2% V5 1_1891del;2342_2343ins318;2873_3418del n/a
3 TRCN0000466464 TGAAACAATCAAACCGGCTCGCCA pLX_317 33.4% 26.2% V5 1_1891del;2342_2343ins318;2873_3418del n/a
Download CSV