Transcript: Human XM_017000891.1

PREDICTED: Homo sapiens RUN and SH3 domain containing 1 (RUSC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUSC1 (23623)
Length:
4062
CDS:
400..3519

Additional Resources:

NCBI RefSeq record:
XM_017000891.1
NBCI Gene record:
RUSC1 (23623)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000891.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439758 CGTCAGCGTCTCCGTTGATAA pLKO_005 2280 CDS 100% 13.200 18.480 N RUSC1 n/a
2 TRCN0000439484 CCATTGTCGGTGCTCACTTTC pLKO_005 2767 CDS 100% 10.800 15.120 N RUSC1 n/a
3 TRCN0000160233 CACGTCTGTTTCTGCTAATAT pLKO.1 3629 3UTR 100% 15.000 10.500 N RUSC1 n/a
4 TRCN0000428555 CCAAGTTGCCTGTATTGATAA pLKO_005 3930 3UTR 100% 13.200 9.240 N RUSC1 n/a
5 TRCN0000166441 CCCACGTCTGTTTCTGCTAAT pLKO.1 3627 3UTR 100% 10.800 7.560 N RUSC1 n/a
6 TRCN0000161335 GACCTCCTTCTTCATCCATAA pLKO.1 3815 3UTR 100% 10.800 7.560 N RUSC1 n/a
7 TRCN0000161608 GTATACCTCCCTTGTTCTGTA pLKO.1 3498 CDS 100% 4.950 3.465 N RUSC1 n/a
8 TRCN0000166827 CAGGAGCAGAAGAAAGGTCTT pLKO.1 2251 CDS 100% 4.050 2.835 N RUSC1 n/a
9 TRCN0000159995 CAGAAGAAAGGTCTTCTGATA pLKO.1 2257 CDS 100% 0.495 0.347 N RUSC1 n/a
10 TRCN0000161105 GCAGAAGAAAGGTCTTCTGAT pLKO.1 2256 CDS 100% 0.495 0.347 N RUSC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000891.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02811 pDONR223 100% 41.6% 41.6% None 1_1818del n/a
2 ccsbBroad304_02811 pLX_304 0% 41.6% 41.6% V5 1_1818del n/a
3 TRCN0000466464 TGAAACAATCAAACCGGCTCGCCA pLX_317 33.4% 41.6% 41.6% V5 1_1818del n/a
Download CSV