Construct: ORF TRCN0000466473
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003981.1_s317c1
- Derived from:
- ccsbBroadEn_12279
- DNA Barcode:
- CCTCCGAACACCAGAGGGGATAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNF130 (55819)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466473
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55819 | RNF130 | ring finger protein 130 | NM_018434.6 | 65.7% | 65.8% | 1_429del;1134C>T |
| 2 | human | 55819 | RNF130 | ring finger protein 130 | XM_011534593.3 | 60.5% | 57% | (many diffs) |
| 3 | human | 55819 | RNF130 | ring finger protein 130 | XM_024446129.1 | 57.8% | 55.1% | (many diffs) |
| 4 | human | 55819 | RNF130 | ring finger protein 130 | NM_001280801.2 | 57.4% | 57.2% | (many diffs) |
| 5 | mouse | 59044 | Rnf130 | ring finger protein 130 | NM_021540.4 | 61.3% | 65.1% | (many diffs) |
| 6 | mouse | 59044 | Rnf130 | ring finger protein 130 | NM_001290750.1 | 54.8% | 56.1% | (many diffs) |
| 7 | mouse | 59044 | Rnf130 | ring finger protein 130 | NM_001290749.1 | 53% | 56.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 897
- ORF length:
- 828
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gactcatcca ggcactggag atattattgc tgtcatgata acagaattga 121 ggggtaagga tattttgagt tatctggaga aaaacatctc tgtacaaatg acaatagctg 181 ttggaactcg aatgccaccg aagaacttca gccgtggctc tctagtcttc gtgtcaatat 241 cctttattgt tttgatgatt atttcttcag catggctcat attctacttc attcagaaga 301 tcaggtacac aaatgcacgc gacaggaacc agcgtcgtct cggagatgca gccaagaaag 361 ccatcagtaa attgacaacc aggacagtaa agaagggtga caaggaaact gacccagact 421 ttgatcattg tgcagtctgc atagagagct ataagcagaa tgatgtcgtc cgaattctcc 481 cctgcaagca tgttttccac aaaTCCTGCG TGGATCCCTG GCTTAGTGAA CATTGTACCT 541 GTCCTATGTG CAAACTTAAT ATATTGAAGG CCCTGGGAAT TGTGCCGAAT TTGCCATGTA 601 CTGATAACGT AGCATTCGAT ATGGAAAGGC TCACCAGAAC CCAAGCTGTT AACCGAAGAT 661 CAGCCCTCGG CGACCTCGCC GGCGACAACT CCCTTGGCCT TGAGCCACTT CGAACTTCGG 721 GGATCTCACC TCTTCCTCAG GATGGGGAGC TCACTCCGAG AACAGGAGAA ATTAACATTG 781 CAGTAACAAA AGAATGGTTT ATTATTGCCA GTTTTGGCCT CCTCAGTGCC CTCACACTCT 841 GCTACATGAT CATCAGAGCC ACAGCTAGCT TGAATGCTAA TGAGGTAGAA TGGTTTTTGC 901 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 961 TCGATTCTAC GTAGTAATGA ACTAGCCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1021 ATATATCTTG TGGAAAGGAC GACCTCCGAA CACCAGAGGG GATAGCACGC GTTAAGTCga 1081 caatcaacct ctggattaca aaatttgtga aagatt