Transcript: Human XM_024446129.1

PREDICTED: Homo sapiens ring finger protein 130 (RNF130), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF130 (55819)
Length:
4114
CDS:
41..1387

Additional Resources:

NCBI RefSeq record:
XM_024446129.1
NBCI Gene record:
RNF130 (55819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007729 CCTGGGAATTGTGCCGAATTT pLKO.1 973 CDS 100% 13.200 9.240 N RNF130 n/a
2 TRCN0000277842 CCTGGGAATTGTGCCGAATTT pLKO_005 973 CDS 100% 13.200 9.240 N RNF130 n/a
3 TRCN0000007730 CGGTTCTTTGTCCCTCCTAAT pLKO.1 320 CDS 100% 10.800 7.560 N RNF130 n/a
4 TRCN0000277743 CGGTTCTTTGTCCCTCCTAAT pLKO_005 320 CDS 100% 10.800 7.560 N RNF130 n/a
5 TRCN0000007727 CCTGGCTTAGTGAACATTGTA pLKO.1 918 CDS 100% 5.625 3.938 N RNF130 n/a
6 TRCN0000277744 CCTGGCTTAGTGAACATTGTA pLKO_005 918 CDS 100% 5.625 3.938 N RNF130 n/a
7 TRCN0000007728 GCTGTAGTCATCTACAATAAT pLKO.1 425 CDS 100% 1.500 1.050 N RNF130 n/a
8 TRCN0000277807 GCTGTAGTCATCTACAATAAT pLKO_005 425 CDS 100% 1.500 1.050 N RNF130 n/a
9 TRCN0000087200 GTTGCTGTAGTCATCTACAAT pLKO.1 422 CDS 100% 0.563 0.394 N Rnf130 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08593 pDONR223 100% 89.1% 86.8% None (many diffs) n/a
2 ccsbBroad304_08593 pLX_304 0% 89.1% 86.8% V5 (many diffs) n/a
3 TRCN0000477021 GATGTACTTGATTATTTGTGTAAA pLX_317 31.5% 89.1% 86.8% V5 (many diffs) n/a
4 ccsbBroadEn_12279 pDONR223 100% 57.8% 55.1% None (many diffs) n/a
5 ccsbBroad304_12279 pLX_304 0% 57.8% 55.1% V5 (many diffs) n/a
6 TRCN0000466473 CCTCCGAACACCAGAGGGGATAGC pLX_317 47.4% 57.8% 55.1% V5 (many diffs) n/a
Download CSV