Transcript: Mouse NM_001290750.1

Mus musculus ring finger protein 130 (Rnf130), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rnf130 (59044)
Length:
7895
CDS:
71..1330

Additional Resources:

NCBI RefSeq record:
NM_001290750.1
NBCI Gene record:
Rnf130 (59044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290750.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007730 CGGTTCTTTGTCCCTCCTAAT pLKO.1 350 CDS 100% 10.800 15.120 N RNF130 n/a
2 TRCN0000277743 CGGTTCTTTGTCCCTCCTAAT pLKO_005 350 CDS 100% 10.800 15.120 N RNF130 n/a
3 TRCN0000087199 TCTTCGTGTCAATCTCCTTTA pLKO.1 657 CDS 100% 10.800 8.640 N Rnf130 n/a
4 TRCN0000087201 CGCACGGGTGAAATCAACATT pLKO.1 1190 CDS 100% 5.625 4.500 N Rnf130 n/a
5 TRCN0000087198 GAAAGCTATAAGCAGAATGAT pLKO.1 875 CDS 100% 5.625 3.938 N Rnf130 n/a
6 TRCN0000007728 GCTGTAGTCATCTACAATAAT pLKO.1 455 CDS 100% 1.500 1.050 N RNF130 n/a
7 TRCN0000277807 GCTGTAGTCATCTACAATAAT pLKO_005 455 CDS 100% 1.500 1.050 N RNF130 n/a
8 TRCN0000087200 GTTGCTGTAGTCATCTACAAT pLKO.1 452 CDS 100% 0.563 0.394 N Rnf130 n/a
9 TRCN0000087202 ACTGATAATGTAGCCTTTGAT pLKO.1 1031 CDS 100% 5.625 3.375 N Rnf130 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290750.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08593 pDONR223 100% 85.4% 87.7% None (many diffs) n/a
2 ccsbBroad304_08593 pLX_304 0% 85.4% 87.7% V5 (many diffs) n/a
3 TRCN0000477021 GATGTACTTGATTATTTGTGTAAA pLX_317 31.5% 85.4% 87.7% V5 (many diffs) n/a
4 ccsbBroadEn_12279 pDONR223 100% 54.8% 56.1% None (many diffs) n/a
5 ccsbBroad304_12279 pLX_304 0% 54.8% 56.1% V5 (many diffs) n/a
6 TRCN0000466473 CCTCCGAACACCAGAGGGGATAGC pLX_317 47.4% 54.8% 56.1% V5 (many diffs) n/a
Download CSV