Construct: ORF TRCN0000466525
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000082.1_s317c1
- Derived from:
- ccsbBroadEn_09890
- DNA Barcode:
- ACCTGACCATGTGGGCGGTTTGAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ATP6V1C2 (245973)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466525
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | NM_144583.4 | 99.9% | 99.7% | 427A>G |
| 2 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XM_011510340.3 | 97.3% | 96.9% | 284_313del;457A>G |
| 3 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | NM_001039362.2 | 89.1% | 88.9% | 427A>G;826_963del |
| 4 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XM_017003745.2 | 89.1% | 88.9% | 427A>G;826_963del |
| 5 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XM_011510339.3 | 87.1% | 86.7% | 284_313del;457A>G;856_993del |
| 6 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XR_922661.1 | 60.3% | (many diffs) | |
| 7 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XM_011510341.2 | 55.2% | 53.5% | (many diffs) |
| 8 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XR_922663.3 | 41.6% | (many diffs) | |
| 9 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XR_922658.3 | 40.9% | (many diffs) | |
| 10 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XR_922662.3 | 40.5% | (many diffs) | |
| 11 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XR_922657.3 | 40.5% | (many diffs) | |
| 12 | human | 245973 | ATP6V1C2 | ATPase H+ transporting V1 s... | XR_922664.3 | 32.8% | (many diffs) | |
| 13 | mouse | 68775 | Atp6v1c2 | ATPase, H+ transporting, ly... | XM_006515199.3 | 86% | 92.6% | (many diffs) |
| 14 | mouse | 68775 | Atp6v1c2 | ATPase, H+ transporting, ly... | XM_006515198.3 | 83.8% | 90% | (many diffs) |
| 15 | mouse | 68775 | Atp6v1c2 | ATPase, H+ transporting, ly... | NM_133699.2 | 76.7% | 82.6% | (many diffs) |
| 16 | mouse | 68775 | Atp6v1c2 | ATPase, H+ transporting, ly... | NM_001159632.1 | 74.9% | 80.5% | (many diffs) |
| 17 | mouse | 68775 | Atp6v1c2 | ATPase, H+ transporting, ly... | XM_006515196.3 | 74.9% | 80.5% | (many diffs) |
| 18 | mouse | 68775 | Atp6v1c2 | ATPase, H+ transporting, ly... | XM_017315176.1 | 58% | 51.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1209
- ORF length:
- 1143
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggagttttgg ttaatttctg cccctggcga taaggaaaat ttgcaagctc 121 tggagaggat gaatactgta acctccaagt ccaacctgtc ttataatacc aaattcgcta 181 ttcctgactt caaggtgggg accttggatt ccctggttgg cctctctgat gagttgggga 241 aactcgacac ctttgctgaa agcctcataa ggagaatggc tcagagcgtg gtggaagtca 301 tggaggactc aaaggggaag gtccaggagc acctcctggc aaacggagtt gacttaacat 361 cctttgtgac ccactttgaa tgggacatgg ccaaatatcc tgtcaagcag ccgctcgtga 421 gtgtggtgga cacaatagcc aagcaactgg cgcagatcga gatggacctg aagtcccgaa 481 cggccgccta cgacactctg aagacaaacc tggagaacct ggaaaagaaa tccatgggga 541 acctcttcac ccggacactg agtgatattg tgagcaaaga ggacttcgtg ctggattctg 601 aatatctcgt cacacttctg gtcatcgtcc ccaaaccaaa ctactcacaa tggcaaaaaa 661 cctacgaatc tctctcagac atggtggtcc ctcgatcaac caaactcatt actgaggaca 721 aggaaggggg ccttttcact gtgactctgt ttcgaaaagt gattgaagat ttcaaaacca 781 aggccaaaga aaacaagttc actgttcgtg aattttacta tgatgagaag gaaattgaaa 841 gggaaaggga ggagatggcc agattgctgt ctgataagaa gcaacagtat ggccccctgc 901 tgcgctggct caaggtgaac ttcagtgaag ccttcattgc ctggatccac atcaaggccc 961 TGAGAGTGTT TGTGGAGTCC GTGCTCAGGT ATGGACTACC AGTGAACTTC CAGGCAGTGC 1021 TCCTGCAGCC GCATAAGAAG TCATCCACCA AGCGTTTAAG AGAGGTTCTA AACTCTGTCT 1081 TCCGACATCT GGATGAAGTA GCCGCTACAA GTATACTGGA TGCATCTGTG GAGATCCCGG 1141 GACTGCAACT CAATAACCAA GACTATTTTC CTTATGTCTA CTTCCATATT GACCTTAGTC 1201 TTCTTGACTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1261 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1321 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAACCTGA CCATGTGGGC GGTTTGAGAC 1381 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt