Transcript: Mouse NM_133699.2

Mus musculus ATPase, H+ transporting, lysosomal V1 subunit C2 (Atp6v1c2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1c2 (68775)
Length:
1567
CDS:
146..1429

Additional Resources:

NCBI RefSeq record:
NM_133699.2
NBCI Gene record:
Atp6v1c2 (68775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101541 CCTTTGCTGAAAGCCTCATAA pLKO.1 330 CDS 100% 13.200 9.240 N Atp6v1c2 n/a
2 TRCN0000101542 GCTCAGCAACCAGGACTATTT pLKO.1 1366 CDS 100% 13.200 9.240 N Atp6v1c2 n/a
3 TRCN0000101540 CCCTCGGTCAACCAAATTGAT pLKO.1 769 CDS 100% 5.625 3.938 N Atp6v1c2 n/a
4 TRCN0000101544 GCTCTGGAAAGGATGAACAAT pLKO.1 197 CDS 100% 5.625 3.938 N Atp6v1c2 n/a
5 TRCN0000101543 ACAAGTTCATTGTCCGGGAAT pLKO.1 873 CDS 100% 4.050 2.835 N Atp6v1c2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09890 pDONR223 100% 76.7% 82.6% None (many diffs) n/a
2 ccsbBroad304_09890 pLX_304 0% 76.7% 82.6% V5 (many diffs) n/a
3 TRCN0000466525 ACCTGACCATGTGGGCGGTTTGAG pLX_317 22.2% 76.7% 82.6% V5 (many diffs) n/a
Download CSV