Construct: ORF TRCN0000466530
Construct Description:
- Construct Type:
 - ORF
 - Other Identifiers:
 - ORF009477.1_s317c1
 - Derived from:
 - ccsbBroadEn_00030
 - DNA Barcode:
 - CTAGACATACATGATGCGGCACCT
 - Epitope Tag:
 - V5
 - Notes:
 - No stop codon in insert
 
Originally Annotated References:
- Gene:
 - ADORA2B (136)
 
Vector Information:
- Vector Backbone:
 - pLX_317
 - Pol II Cassette 1:
 - SV40-PuroR
 - Pol II Cassette 2:
 - EF1a-TRCN0000466530
 - Selection Marker:
 - PuroR
 - Visible Reporter:
 - n/a
 - Epitope Tag:
 - n/a
 
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows:  total nt. matches ---------------------------------- aligned length (incl. gaps)  | 
              Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows:  total aa. matches ---------------------------------- aligned length (incl. gaps)  | 
              Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 136 | ADORA2B | adenosine A2b receptor | NM_000676.2 | 100% | 100% | |
| 2 | human | 136 | ADORA2B | adenosine A2b receptor | XM_011523659.3 | 67.9% | 67.1% | (many diffs) | 
| 3 | human | 136 | ADORA2B | adenosine A2b receptor | XM_017024197.2 | 67.9% | 66.2% | (many diffs) | 
| 4 | human | 136 | ADORA2B | adenosine A2b receptor | XR_001752428.1 | 43.1% | 1_523del;858_1237del;1900_2306del | |
| 5 | human | 136 | ADORA2B | adenosine A2b receptor | XM_011523661.2 | 34.3% | 33.7% | (many diffs) | 
| 6 | mouse | 11541 | Adora2b | adenosine A2b receptor | NM_007413.4 | 87.4% | 87.6% | (many diffs) | 
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
 - 66
 - ORF end:
 - 1062
 - ORF length:
 - 996
 - Sequence:
 - 
          
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gctggagaca caggacgcgc tgtacgtggc gctggagctg gtcatcgccg 121 cgctttcggt ggcgggcaac gtgctggtgt gcgccgcggt gggcacggcg aacactctgc 181 agacgcccac caactacttc ctggtgtccc tggctgcggc cgacgtggcc gtggggctct 241 tcgccatccc ctttgccatc accatcagcc tgggcttctg cactgacttc tacggctgcc 301 tcttcctcgc ctgcttcgtg ctggtgctca cgcagagctc catcttcagc cttctggccg 361 tggcagtcga cagatacctg gccatctgtg tcccgctcag gtataaaagt ttggtcacgg 421 ggacccgagc aagaggggtc attgctgtcc tctgggtcct tgcctttggc atcggattga 481 ctccattcct ggggtggaac agtaaagaca gtgccaccaa caactgcaca gaaccctggg 541 atggaaccac gaatgaaagc tgctgccttg tgaagtgtct ctttgagaat gtggtcccca 601 tgagctacat ggtatatttc aatttctttg ggtgtgttct gcccccactg cttataatgc 661 tggtgatcta cattaagatc ttcctggtgg cctgcaggca gcttcagcgc actgagctga 721 tggaccactc gaggaccacc cTCCAGCGGG AGATCCATGC AGCCAAGTCA CTGGCCATGA 781 TTGTGGGGAT TTTTGCCCTG TGCTGGTTAC CTGTGCATGC TGTTAACTGT GTCACTCTTT 841 TCCAGCCAGC TCAGGGTAAA AATAAGCCCA AGTGGGCAAT GAATATGGCC ATTCTTCTGT 901 CACATGCCAA TTCAGTTGTC AATCCCATTG TCTATGCTTA CCGGAACCGA GACTTCCGCT 961 ACACTTTTCA CAAAATTATC TCCAGGTATC TTCTCTGCCA AGCAGATGTC AAGAGTGGGA 1021 ATGGTCAGGC TGGGGTACAG CCTGCTCTCG GTGTGGGCCT ATGCCCAACT TTCTTGTACA 1081 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1141 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1201 AGGACGACTA GACATACATG ATGCGGCACC TACGCGTTAA GTCgacaatc aacctctgga 1261 ttacaaaatt tgtgaaagat t