Transcript: Human XM_017024197.2

PREDICTED: Homo sapiens adenosine A2b receptor (ADORA2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADORA2B (136)
Length:
1513
CDS:
414..1109

Additional Resources:

NCBI RefSeq record:
XM_017024197.2
NBCI Gene record:
ADORA2B (136)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065333 GCTAATATGTATGTGTCAGTA pLKO.1 1256 3UTR 100% 4.950 3.960 N ADORA2B n/a
2 TRCN0000289320 GCTAATATGTATGTGTCAGTA pLKO_005 1256 3UTR 100% 4.950 3.960 N ADORA2B n/a
3 TRCN0000065337 GCAATGAATATGGCCATTCTT pLKO.1 921 CDS 100% 5.625 3.938 N ADORA2B n/a
4 TRCN0000065334 GCTGGTGATCTACATTAAGAT pLKO.1 704 CDS 100% 5.625 3.938 N ADORA2B n/a
5 TRCN0000289318 GCTGGTGATCTACATTAAGAT pLKO_005 704 CDS 100% 5.625 3.938 N ADORA2B n/a
6 TRCN0000065335 GCAGATGTCAAGAGTGGGAAT pLKO.1 1047 CDS 100% 4.050 2.835 N ADORA2B n/a
7 TRCN0000289245 GCAGATGTCAAGAGTGGGAAT pLKO_005 1047 CDS 100% 4.050 2.835 N ADORA2B n/a
8 TRCN0000065336 CCCATGAGCTACATGGTATAT pLKO.1 642 CDS 100% 1.320 0.924 N ADORA2B n/a
9 TRCN0000289243 CCCATGAGCTACATGGTATAT pLKO_005 642 CDS 100% 1.320 0.924 N ADORA2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00030 pDONR223 100% 67.9% 66.2% None (many diffs) n/a
2 ccsbBroad304_00030 pLX_304 0% 67.9% 66.2% V5 (many diffs) n/a
3 TRCN0000466530 CTAGACATACATGATGCGGCACCT pLX_317 32.5% 67.9% 66.2% V5 (many diffs) n/a
4 TRCN0000489321 AACCTCTGCTACATCAAACACCTG pLX_317 39.5% 67.9% 66.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488692 GCCCGGATTCGCGATTTCAGGGCG pLX_317 37% 67.7% 66.2% V5 (many diffs) n/a
Download CSV