Transcript: Human XM_011523661.2

PREDICTED: Homo sapiens adenosine A2b receptor (ADORA2B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADORA2B (136)
Length:
3856
CDS:
455..805

Additional Resources:

NCBI RefSeq record:
XM_011523661.2
NBCI Gene record:
ADORA2B (136)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488692 GCCCGGATTCGCGATTTCAGGGCG pLX_317 37% 34.3% 33.7% V5 (many diffs) n/a
2 ccsbBroadEn_00030 pDONR223 100% 34.3% 33.7% None (many diffs) n/a
3 ccsbBroad304_00030 pLX_304 0% 34.3% 33.7% V5 (many diffs) n/a
4 TRCN0000466530 CTAGACATACATGATGCGGCACCT pLX_317 32.5% 34.3% 33.7% V5 (many diffs) n/a
5 TRCN0000489321 AACCTCTGCTACATCAAACACCTG pLX_317 39.5% 34.3% 33.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV