Construct: ORF TRCN0000466533
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006631.1_s317c1
- Derived from:
- ccsbBroadEn_04852
- DNA Barcode:
- GCGCATGGCTTCGAAATGATGGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NUP35 (129401)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466533
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 129401 | NUP35 | nucleoporin 35 | NM_138285.5 | 100% | 100% | |
2 | human | 129401 | NUP35 | nucleoporin 35 | XM_017003308.1 | 97% | 95.7% | (many diffs) |
3 | human | 129401 | NUP35 | nucleoporin 35 | NM_001287584.1 | 94.7% | 94.7% | 0_1ins51 |
4 | human | 129401 | NUP35 | nucleoporin 35 | XM_006712254.3 | 94.7% | 94.7% | 0_1ins51 |
5 | human | 129401 | NUP35 | nucleoporin 35 | XM_011510576.3 | 94.7% | 94.7% | 0_1ins51 |
6 | human | 129401 | NUP35 | nucleoporin 35 | XM_011510577.2 | 94.7% | 94.7% | 0_1ins51 |
7 | human | 129401 | NUP35 | nucleoporin 35 | NM_001287585.1 | 63.8% | 63.8% | 0_1ins354 |
8 | human | 129401 | NUP35 | nucleoporin 35 | NR_109856.1 | 51% | 1_103del;499_500ins142;940_1495del | |
9 | mouse | 69482 | Nup35 | nucleoporin 35 | NM_027091.4 | 88% | 92.9% | (many diffs) |
10 | mouse | 69482 | Nup35 | nucleoporin 35 | NM_001190179.1 | 83.5% | 88.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1044
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agcctttgca gtggaacctc aggggcccgc gttaggatct gaaccaatga 121 tgctgggttc acccacatct ccaaagccag gagttaatgc ccagttctta cctggatttt 181 taatggggga tttgccagct ccggtgactc cacaacctcg atcaattagt ggcccttcag 241 taggagtaat ggaaatgaga tcacctttac ttgcaggtgg gtcaccacca caaccagttg 301 taccagctca taaagataaa agtggcgctc caccagttag aagtatatat gatgacattt 361 ctagcccagg acttggatca acacctttaa cttcaagaag acagccaaac atttcagtaa 421 tgcagagtcc tcttgttgga gttacatcta ctcctggaac agggcaaagt atgtttagtc 481 cagcaagtat cggtcagcca cgaaagacga cattatctcc tgcccagttg gatccttttt 541 atactcaagg agattctttg acttcagaag atcacctcga tgactcttgg gtgactgtat 601 ttgggtttcc tcaagcatct gcttcctaca tattactaca atttgcacag tatgggaata 661 tcttaaaaca tgtgatgtct aatacaggaa attGGATGCA TATTCGTTAT CAATCTAAAC 721 TGCAGGCTCG GAAAGCCTTA AGCAAAGATG GGAGGATTTT TGGAGAATCC ATCATGATTG 781 GTGTAAAACC ATGTATTGAC AAAAGTGTTA TGGAAAGCAG TGACAGATGT GCTTTATCAT 841 CTCCATCTTT AGCCTTTACA CCACCAATCA AAACTCTAGG TACACCAACA CAACCTGGAA 901 GTACTCCTAG GATTTCTACC ATGAGACCTC TTGCTACAGC ATACAAAGCC TCTACTAGTG 961 ATTATCAGGT TATTTCTGAC AGACAAACGC CAAAAAAAGA TGAAAGTCTT GTATCCAAAG 1021 CAATGGAGTA CATGTTTGGC TGGTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1081 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1141 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG CGCATGGCTT 1201 CGAAATGATG GTGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1261 att