Transcript: Human XM_011510577.2

PREDICTED: Homo sapiens nucleoporin 35 (NUP35), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP35 (129401)
Length:
2049
CDS:
573..1502

Additional Resources:

NCBI RefSeq record:
XM_011510577.2
NBCI Gene record:
NUP35 (129401)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072382 GACTCCACAACCTCGATCAAT pLKO.1 662 CDS 100% 5.625 7.875 N NUP35 n/a
2 TRCN0000072378 GCTGGTTCCTTCGGTTAGTTA pLKO.1 1554 3UTR 100% 5.625 4.500 N NUP35 n/a
3 TRCN0000072381 GCTTCCTACATATTACTACAA pLKO.1 1077 CDS 100% 4.950 3.960 N NUP35 n/a
4 TRCN0000424175 CATTAAGGATACAACCTATTT pLKO_005 1636 3UTR 100% 13.200 9.240 N NUP35 n/a
5 TRCN0000072379 GCTCCACCAGTTAGAAGTATA pLKO.1 783 CDS 100% 13.200 9.240 N NUP35 n/a
6 TRCN0000412605 TAGTGATTATCAGGTTATTTC pLKO_005 1412 CDS 100% 13.200 9.240 N NUP35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04852 pDONR223 100% 94.7% 94.7% None 0_1ins51 n/a
2 ccsbBroad304_04852 pLX_304 0% 94.7% 94.7% V5 0_1ins51 n/a
3 TRCN0000466533 GCGCATGGCTTCGAAATGATGGTG pLX_317 36.1% 94.7% 94.7% V5 0_1ins51 n/a
Download CSV