Construct: ORF TRCN0000466579
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003291.1_s317c1
- Derived from:
- ccsbBroadEn_09119
- DNA Barcode:
- ACTGATTAAGACGAGGACTCCACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ROPN1L (83853)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466579
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 83853 | ROPN1L | rhophilin associated tail p... | NM_001201466.2 | 99.8% | 99.5% | 467C>G |
| 2 | human | 83853 | ROPN1L | rhophilin associated tail p... | NM_031916.5 | 99.8% | 99.5% | 467C>G |
| 3 | human | 83853 | ROPN1L | rhophilin associated tail p... | XM_017009947.2 | 90.8% | 86.9% | (many diffs) |
| 4 | human | 83853 | ROPN1L | rhophilin associated tail p... | XM_017009946.2 | 88% | 81.3% | (many diffs) |
| 5 | human | 83853 | ROPN1L | rhophilin associated tail p... | XM_006714504.3 | 83.1% | 79.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 756
- ORF length:
- 690
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gcttcccgac accatgttct gcgctcagca gatccacatt cccccggagc 121 tgccggacat cctgaagcaa ttcaccaagg ctgccatccg cacccagccg gccgacgtgc 181 tgcggtggtc cgcgggctat ttttcagctc tgtcgagagg agatccactt cctgtaaagg 241 acagaatgga aatgcccacg gcaacccaga aaacagacac aggcctgact caaggactcc 301 tgaaagtttt gcacaagcag tgtcaccaca agcggtatgt ggaattaaca gatcttgagc 361 agaagtggaa gaacttgtgc ctgccgaagg aaaaattcaa agcgctctta caactggatc 421 cttgtgaaaa caaaatcaag tggataaact ttttagcgct tGGATGCAGC ATGCTTGGTG 481 GGTCCTTGAA CACTGCGCTG AAGCACCTGT GCGAGATCCT CACGGACGAT CGGGAGGGCG 541 GGCCCGCTCG CATCCCCTTC AAGACGTTTT CCTACGTTTA CCGCTACTTG GCCAGATTAG 601 ACTCAGATGT GTCTCCCTTG GAGACGGAAT CCTACCTTGC CTCTCTAAAG GAAAATATAG 661 ACGCCAGGAA GAACGGCATG ATAGGTCTTT CAGATTTCTT CTTTCCAAAG AGGAAACTTT 721 TAGAAAGCAT TGAAAACTCT GAAGATGTAG GCCATTACCC AACTTTCTTG TACAAAGTGG 781 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 841 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 901 AACTGATTAA GACGAGGACT CCACTACGCG TTAAGTCgac aatcaacctc tggattacaa 961 aatttgtgaa agatt