Transcript: Human XM_017009947.2

PREDICTED: Homo sapiens rhophilin associated tail protein 1 like (ROPN1L), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ROPN1L (83853)
Length:
836
CDS:
159..821

Additional Resources:

NCBI RefSeq record:
XM_017009947.2
NBCI Gene record:
ROPN1L (83853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244130 TACCGCTACTTGGCCAGATTA pLKO_005 672 CDS 100% 0.000 0.000 N ROPN1L n/a
2 TRCN0000244129 CAAGCGGTATGTGGAATTAAC pLKO_005 422 CDS 100% 13.200 9.240 N ROPN1L n/a
3 TRCN0000244126 TGTAAAGGACAGAATGGAAAT pLKO_005 326 CDS 100% 10.800 7.560 N ROPN1L n/a
4 TRCN0000180449 GAGGAGATCCACTTCCTGTAA pLKO.1 310 CDS 100% 4.950 3.465 N ROPN1L n/a
5 TRCN0000179034 CCTGTAAAGGACAGAATGGAA pLKO.1 324 CDS 100% 3.000 2.100 N ROPN1L n/a
6 TRCN0000244128 ATCCTACCTTGCCTCTCTAAA pLKO_005 722 CDS 100% 13.200 7.920 N ROPN1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09119 pDONR223 100% 90.8% 86.9% None (many diffs) n/a
2 ccsbBroad304_09119 pLX_304 0% 90.8% 86.9% V5 (many diffs) n/a
3 TRCN0000466579 ACTGATTAAGACGAGGACTCCACT pLX_317 42.9% 90.8% 86.9% V5 (many diffs) n/a
Download CSV