Transcript: Human NM_031916.5

Homo sapiens rhophilin associated tail protein 1 like (ROPN1L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ROPN1L (83853)
Length:
1061
CDS:
290..982

Additional Resources:

NCBI RefSeq record:
NM_031916.5
NBCI Gene record:
ROPN1L (83853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031916.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244127 GAACGGCATGATAGGTCTTTC pLKO_005 895 CDS 100% 10.800 15.120 N ROPN1L n/a
2 TRCN0000244130 TACCGCTACTTGGCCAGATTA pLKO_005 803 CDS 100% 0.000 0.000 N ROPN1L n/a
3 TRCN0000244129 CAAGCGGTATGTGGAATTAAC pLKO_005 553 CDS 100% 13.200 9.240 N ROPN1L n/a
4 TRCN0000244126 TGTAAAGGACAGAATGGAAAT pLKO_005 457 CDS 100% 10.800 7.560 N ROPN1L n/a
5 TRCN0000180449 GAGGAGATCCACTTCCTGTAA pLKO.1 441 CDS 100% 4.950 3.465 N ROPN1L n/a
6 TRCN0000148090 GCATGATAGGTCTTTCAGATT pLKO.1 900 CDS 100% 4.950 3.465 N ROPN1L n/a
7 TRCN0000179034 CCTGTAAAGGACAGAATGGAA pLKO.1 455 CDS 100% 3.000 2.100 N ROPN1L n/a
8 TRCN0000244128 ATCCTACCTTGCCTCTCTAAA pLKO_005 853 CDS 100% 13.200 7.920 N ROPN1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031916.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09119 pDONR223 100% 99.8% 99.5% None 467C>G n/a
2 ccsbBroad304_09119 pLX_304 0% 99.8% 99.5% V5 467C>G n/a
3 TRCN0000466579 ACTGATTAAGACGAGGACTCCACT pLX_317 42.9% 99.8% 99.5% V5 467C>G n/a
Download CSV