Construct: ORF TRCN0000466587
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008036.1_s317c1
- Derived from:
- ccsbBroadEn_06399
- DNA Barcode:
- AAGCTAGGACAAGGATACTCGCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HPS1 (3257)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466587
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_182639.3 | 99.8% | 100% | 933C>T |
2 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322491.1 | 89.7% | 89.8% | 767_768ins99;834C>T |
3 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322490.1 | 81.3% | 55.6% | (many diffs) |
4 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322492.1 | 71.8% | 56.5% | (many diffs) |
5 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | XM_017016173.1 | 71.8% | 56.5% | (many diffs) |
6 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | XR_001747100.2 | 52.7% | (many diffs) | |
7 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_000195.5 | 45.8% | 45% | (many diffs) |
8 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322476.1 | 45.8% | 45% | (many diffs) |
9 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322477.1 | 45.8% | 45% | (many diffs) |
10 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | XM_005269757.4 | 45.8% | 45% | (many diffs) |
11 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322478.1 | 41.1% | 40.2% | (many diffs) |
12 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322479.1 | 41.1% | 40.2% | (many diffs) |
13 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | XM_024447971.1 | 37.3% | 29.3% | (many diffs) |
14 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | XR_001747099.2 | 33.2% | (many diffs) | |
15 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | XR_001747098.1 | 29.9% | (many diffs) | |
16 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | XR_001747101.2 | 29.8% | (many diffs) | |
17 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322483.1 | 28.3% | 26% | (many diffs) |
18 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322484.1 | 28.3% | 26% | (many diffs) |
19 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | NM_001322485.1 | 23.5% | 21.2% | (many diffs) |
20 | human | 3257 | HPS1 | HPS1 biogenesis of lysosoma... | XM_017016171.2 | 23.5% | 21.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1038
- ORF length:
- 972
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gtgcgtcttg gtggccactg agggcgcaga ggtcctcttc tactggacag 121 atcaggagtt tgaagagagt ctccggctga agttcgggca gtcagagaat gaggaagaag 181 agctccctgc cctggaggac cagctcagca ccctcctagc cccggtcatc atctcctcca 241 tgacgatgct ggagaagctc tcggacacct acacctgctt ctccacggaa aatggcaact 301 tcctgtatgt ccttcacctg tttggagaat gcctgttcat tgccatcaat ggtgaccaca 361 ccgagagcga gggggacctg cggcggaagc tgtatgtgct caagtacctg tttgaagtgc 421 actttgggct ggtgactgtg gacggtcatc ttatccgaaa ggagctgcgg cccccagacc 481 tggcgcagcg tgtccagctg tgggagcact tccagagcct gctgtggacc tacagccgcc 541 tgcgggagca ggagcagtgc ttcgccgtgg aggccctgga gcgactgatt cacccccagc 601 tctgtgagct gtgcatagag gcgctggagc ggcacgtcat ccaggctgtc aacaccagcc 661 ccgagcgggg aggcgaggag gccctgcatg ccttcctgct cgtgcactcc aagctgctgg 721 cattctactc tagccacagt gccagctccc TGCGCCCGGC CGACCTGCTT GCCCTCATCC 781 TCCTGGTTCA GGACCTCTAC CCCAGCGAGA GCACAGCAGA GGACGACATT CAGCCTTCCC 841 CGCGGAGGGC CCGGAGCAGC CAGAACATCC CCGTGCAGCA GGCCTGGAGC CCTCACTCCA 901 CGGGCCCAAC TGGGGGGAGC TCTGCAGAGA CGGAGACAGA CAGCTTCTCC CTCCCTGAGG 961 AGTACTTCAC ACCAGCTCCT TCCCCTGGCG ATCAGAGTTC AGGTGAGGAC CGGAGGAAAG 1021 CAGGAGGAAA CAATAGCTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1081 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1141 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAAAGCTAG GACAAGGATA 1201 CTCGCACACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt