Transcript: Human NM_001322492.1

Homo sapiens HPS1 biogenesis of lysosomal organelles complex 3 subunit 1 (HPS1), transcript variant 20, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
HPS1 (3257)
Length:
1340
CDS:
192..1019

Additional Resources:

NCBI RefSeq record:
NM_001322492.1
NBCI Gene record:
HPS1 (3257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380407 GACGGTCATCTTATCCGAAAG pLKO_005 567 CDS 100% 6.000 8.400 N HPS1 n/a
2 TRCN0000379764 ACTGGACAGATCAGGAGTTTG pLKO_005 238 CDS 100% 10.800 7.560 N HPS1 n/a
3 TRCN0000382402 CCTTCACCTGTTTGGAGAATG pLKO_005 437 CDS 100% 10.800 7.560 N HPS1 n/a
4 TRCN0000082871 GTGCTCAAGTACCTGTTTGAA pLKO.1 522 CDS 100% 5.625 3.938 N HPS1 n/a
5 TRCN0000082869 GTCCTCTTCTACTGGACAGAT pLKO.1 228 CDS 100% 4.950 3.465 N HPS1 n/a
6 TRCN0000082872 CCTGTATGTCCTTCACCTGTT pLKO.1 428 CDS 100% 4.050 2.835 N HPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06399 pDONR223 100% 71.8% 56.5% None (many diffs) n/a
2 ccsbBroad304_06399 pLX_304 0% 71.8% 56.5% V5 (many diffs) n/a
3 TRCN0000466587 AAGCTAGGACAAGGATACTCGCAC pLX_317 30% 71.8% 56.5% V5 (many diffs) n/a
Download CSV