Construct: ORF TRCN0000466599
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005457.1_s317c1
- Derived from:
- ccsbBroadEn_11713
- DNA Barcode:
- TATTGTCTCCGAAAGTGACATGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SMG6 (23293)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466599
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | NM_001256827.2 | 100% | 100% | |
| 2 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | NM_001256828.1 | 100% | 100% | |
| 3 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | XM_005256571.5 | 100% | 100% | |
| 4 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | XM_011523775.2 | 100% | 100% | |
| 5 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | XM_017024399.2 | 100% | 100% | |
| 6 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | NM_001282326.1 | 62.1% | 59.6% | (many diffs) |
| 7 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | XM_005256569.4 | 36.8% | 36.8% | 1_2631del |
| 8 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | XM_011523769.2 | 36.8% | 36.8% | 1_2631del |
| 9 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | XM_024450681.1 | 36.8% | 36.8% | 1_2631del |
| 10 | human | 23293 | SMG6 | SMG6 nonsense mediated mRNA... | NM_017575.5 | 36% | 36% | 1_2724del |
| 11 | mouse | 103677 | Smg6 | Smg-6 homolog, nonsense med... | XM_011248660.1 | 92.6% | 97.6% | (many diffs) |
| 12 | mouse | 103677 | Smg6 | Smg-6 homolog, nonsense med... | XM_011248659.2 | 33.6% | 35.5% | (many diffs) |
| 13 | mouse | 103677 | Smg6 | Smg-6 homolog, nonsense med... | NM_001002764.1 | 33.3% | 35.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1599
- ORF length:
- 1533
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gacattccct gcagtggctg agaaggtcct caaggagttc caggtgttac 121 tgcagcacag cccctctccc attggaagta cccgcatgct gcagcttatg accatcaata 181 tgtttgcagt acacaactcc cagctgaaag actgcttctc ggaggagtgc cgctctgtga 241 tccaggaaca agccgcagct ctgggcttgg ccatgttttc tctactggtc cgccgctgca 301 cctgcttact taaggagtcc gccaaagctc agctgtcctc tcctgaggac caggatgacc 361 aagacgacat caaggtgtct tcctttgtcc cggacctgaa ggagctgctc cccagtgtca 421 aagtctggtc agattggatg ctcggctacc cggacacctg gaatcctcct cccacatccc 481 tggatctgcc ctcgcatgtt gctgtggatg tatggtcgac gctggctgat ttctgtaaca 541 tactgactgc agtgaatcag tctgaggtgc cactgtacaa ggacccggat gatgacctca 601 cccttcttat cctggaagag gatcggcttc tctcgggctt tgtccccttg ctggctgccc 661 ctcaggaccc ctgctacgtg gagaaaacct cggataaggt tattgcagct gactgcaaaa 721 gggtcacagt gctgaagtat tttctggaag ccctttgtgg acaagaagag cctctgctgg 781 cattcaaggg tggaaagtat gtgtcagtgg cacccgtccc agacaccatg ggaaaggaaa 841 tgggaagcca agagggaaca cgactggaag atgaggagga ggatgtggtg attgaagact 901 ttgaggaaga ttcagaggct gaaggcagcg gaggcgagga tgacatcagg gagcttcggg 961 ccaagaagct ggctctggcc aggaagatag ctgagcagca gcgtcgccag gaaaagatcc 1021 aggctgtcct ggaggaccac agtcagatga ggcagatgga gctcgaaatc agacctttgt 1081 tcctcgtacc agacaccaac ggcttcattg accacctggc cagtctggcg cggctgctgg 1141 agagcaggaa gtacatcctg gtggtgcccc tcatcgtgat caatgagctg gacggcctgg 1201 ccaaggggca ggagacagac caccgggctg ggggcTACGC CCGTGTGGTA CAAGAGAAGG 1261 CCCGCAAGTC CATCGAGTTC CTCGAGCAGC GATTCGAGAG TCGGGACTCT TGCCTGCGAG 1321 CCCTGACCAG CCGTGGCAAT GAACTCGAAT CCATCGCCTT CCGCAGTGAG GACATCACTG 1381 GCCAGCTGGG TAACAACGAT GATCTCATCC TGTCCTGCTG CCTCCACTAC TGCAAAGACA 1441 AGGCTAAGGA CTTCATGCCC GCCAGCAAAG AGGAGCCAAT CCGGCTACTG CGGGAGGTGG 1501 TGCTGTTGAC GGATGACCGG AACCTGCGTG TGAAGGCGCT CACAAGGAAT GTTCCTGTAC 1561 GGGACATCCC AGCCTTCCTC ACGTGGGCCC AGGTGGGCTG CCCAACTTTC TTGTACAAAG 1621 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1681 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1741 ACGATATTGT CTCCGAAAGT GACATGGTAC GCGTTAAGTC gacaatcaac ctctggatta 1801 caaaatttgt gaaagatt