Transcript: Mouse XM_011248659.2

PREDICTED: Mus musculus Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) (Smg6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smg6 (103677)
Length:
4733
CDS:
383..4600

Additional Resources:

NCBI RefSeq record:
XM_011248659.2
NBCI Gene record:
Smg6 (103677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257089 TGATCGGAACCTTCGTGTAAA pLKO_005 4513 CDS 100% 13.200 18.480 N Smg6 n/a
2 TRCN0000174532 CCGAAGTCTAAAGATCATCAA pLKO.1 727 CDS 100% 4.950 6.930 N Smg6 n/a
3 TRCN0000241952 TACCCAGTAGGCCCTACAAAT pLKO_005 1928 CDS 100% 0.000 0.000 N Smg6 n/a
4 TRCN0000241955 TACCAATCCACCCAGACAATA pLKO_005 4692 3UTR 100% 0.000 0.000 N Smg6 n/a
5 TRCN0000217470 GCCCAAGCATCTTACTATAAA pLKO.1 1820 CDS 100% 15.000 10.500 N Smg6 n/a
6 TRCN0000241953 GTGTAAGGGAGAAGCTATAAA pLKO_005 883 CDS 100% 15.000 10.500 N Smg6 n/a
7 TRCN0000241954 GCGCTGCACATGCCTACTTAA pLKO_005 3292 CDS 100% 13.200 9.240 N Smg6 n/a
8 TRCN0000174586 GAAGTTAATAACAAACCGGAT pLKO.1 908 CDS 100% 2.160 1.512 N Smg6 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 228 5UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11713 pDONR223 100% 33.6% 35.5% None (many diffs) n/a
2 ccsbBroad304_11713 pLX_304 0% 33.6% 35.5% V5 (many diffs) n/a
3 TRCN0000466599 TATTGTCTCCGAAAGTGACATGGT pLX_317 24% 33.6% 35.5% V5 (many diffs) n/a
Download CSV