Construct: ORF TRCN0000466711
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004571.1_s317c1
- Derived from:
- ccsbBroadEn_05256
- DNA Barcode:
- CAAAGAGGTTTAGCCGCCCGACTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RSPH9 (221421)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466711
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 221421 | RSPH9 | radial spoke head component 9 | NM_152732.5 | 100% | 100% | |
2 | human | 221421 | RSPH9 | radial spoke head component 9 | XM_005248901.3 | 85.9% | 72.2% | 669_765del;926_963del |
3 | human | 221421 | RSPH9 | radial spoke head component 9 | NM_001193341.1 | 81.3% | 67.6% | 392_393ins45;624_720del;881_918del |
4 | human | 221421 | RSPH9 | radial spoke head component 9 | XR_002956268.1 | 75.7% | (many diffs) | |
5 | human | 221421 | RSPH9 | radial spoke head component 9 | XR_926099.2 | 75.1% | 1_42del;711_848del;938_939ins70 | |
6 | human | 221421 | RSPH9 | radial spoke head component 9 | XR_002956269.1 | 62.6% | (many diffs) | |
7 | mouse | 75564 | Rsph9 | radial spoke head 9 homolog... | NM_029338.3 | 88.1% | 91.6% | (many diffs) |
8 | mouse | 75564 | Rsph9 | radial spoke head 9 homolog... | XM_006525074.3 | 76% | 74% | (many diffs) |
9 | mouse | 75564 | Rsph9 | radial spoke head 9 homolog... | XM_006525075.3 | 70.6% | 72.8% | (many diffs) |
10 | mouse | 75564 | Rsph9 | radial spoke head 9 homolog... | XM_011246700.2 | 44.4% | 45.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 894
- ORF length:
- 828
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cgccgacagc ctcctgctgt ctctggagct ggcgtccggc agtgggcagg 121 gcctcagccc ggaccgtcgg gcctcgctgc tcacgtctct tatgctggtt aagcgcgact 181 accgctatga tcgggttctc ttctggggcc gcatccttgg cctcgtcgcc gattactaca 241 tcgcgcaggg cctgagtgag gaccagctcg caccgcgcaa gacgctctat agcctgaact 301 gcacagagtg gagcctcttg ccccctgcca cagaggagat ggtggcgcag tcgtctgtgg 361 tgaagggccg cttcatgggg gacccatcat acgaatatga acacactgag ctgcagaagg 421 tgaatgaagg tgaaaaagtc tttgaagaag aaatagtggt ccagatcaag gaagagaccc 481 gcttggtgtc tgtcattgac cagattgaca aggctgtggc catcatcccc cgaggcgccc 541 tcttcaagac cccttttgga cccacccatg tcaatcggac ctttgaagga ctgtccttgt 601 ctgaggccaa gaagctcagc tcctacttcc atttcaggga gcctgttgag ctaaagaata 661 agaccttgct tgagaaggct gacctggacc cctccctgga tttcatggac tccttggagc 721 atgacattcc caaagggtcc tggagcatcc agatggagag gggcaatgcc ctggtggtgc 781 tgcgcagcct gctctggccg ggcctcacct tctaccatgc tccccgcacc aagaactatG 841 GCTACGTCTA CGTGGGCACT GGCGAGAAGA ACATGGACTT GCCCTTCATG CTATACCCAA 901 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 961 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1021 TATCTTGTGG AAAGGACGAC AAAGAGGTTT AGCCGCCCGA CTAACGCGTT AAGTCgacaa 1081 tcaacctctg gattacaaaa tttgtgaaag att