Transcript: Mouse XM_006525075.3

PREDICTED: Mus musculus radial spoke head 9 homolog (Chlamydomonas) (Rsph9), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rsph9 (75564)
Length:
928
CDS:
95..769

Additional Resources:

NCBI RefSeq record:
XM_006525075.3
NBCI Gene record:
Rsph9 (75564)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184041 CAGGAAGCTTAGCTCGTACTT pLKO.1 637 CDS 100% 4.950 6.930 N Rsph9 n/a
2 TRCN0000180277 CGAGTATGAACACACAGAGTT pLKO.1 421 CDS 100% 4.950 3.465 N Rsph9 n/a
3 TRCN0000184530 GAACAAGACCTTGCTGGAGAA pLKO.1 685 CDS 100% 4.050 2.835 N Rsph9 n/a
4 TRCN0000184618 GCTTAGCTCGTACTTCCACTT pLKO.1 643 CDS 100% 4.050 2.835 N Rsph9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05256 pDONR223 100% 70.6% 72.8% None (many diffs) n/a
2 ccsbBroad304_05256 pLX_304 0% 70.6% 72.8% V5 (many diffs) n/a
3 TRCN0000466711 CAAAGAGGTTTAGCCGCCCGACTA pLX_317 7.6% 70.6% 72.8% V5 (many diffs) n/a
Download CSV