Transcript: Human XR_926099.2

PREDICTED: Homo sapiens radial spoke head component 9 (RSPH9), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RSPH9 (221421)
Length:
938
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_926099.2
NBCI Gene record:
RSPH9 (221421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_926099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133864 GCCTGTTGAGCTAAAGAATAA pLKO.1 618 3UTR 100% 13.200 18.480 N RSPH9 n/a
2 TRCN0000424115 ACGTCTCTTATGCTGGTTAAG pLKO_005 130 3UTR 100% 10.800 7.560 N RSPH9 n/a
3 TRCN0000137428 GCTCAGCTCCTACTTCCATTT pLKO.1 591 3UTR 100% 10.800 7.560 N RSPH9 n/a
4 TRCN0000134591 GAATAAGACCTTGCTTGAGAA pLKO.1 633 3UTR 100% 4.950 3.465 N RSPH9 n/a
5 TRCN0000135435 GTGTCTGTCATTGACCAGATT pLKO.1 463 3UTR 100% 4.950 3.465 N RSPH9 n/a
6 TRCN0000135850 CAGAAGGTGAATGAAGGTGAA pLKO.1 391 3UTR 100% 4.050 2.835 N RSPH9 n/a
7 TRCN0000134486 GCTAAAGAATAAGACCTTGCT pLKO.1 627 3UTR 100% 2.640 1.848 N RSPH9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_926099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05256 pDONR223 100% 75.1% None 1_42del;711_848del;938_939ins70 n/a
2 ccsbBroad304_05256 pLX_304 0% 75.1% V5 1_42del;711_848del;938_939ins70 n/a
3 TRCN0000466711 CAAAGAGGTTTAGCCGCCCGACTA pLX_317 7.6% 75.1% V5 1_42del;711_848del;938_939ins70 n/a
Download CSV