Construct: ORF TRCN0000466720
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018177.1_s317c1
- Derived from:
- ccsbBroadEn_05649
- DNA Barcode:
- TAGATCATCAGTTATGACTCGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CENPP (401541)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466720
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 401541 | CENPP | centromere protein P | NM_001012267.3 | 100% | 100% | |
| 2 | human | 401541 | CENPP | centromere protein P | XM_017014715.2 | 69% | 55.4% | (many diffs) |
| 3 | human | 401541 | CENPP | centromere protein P | XM_024447543.1 | 68% | 68% | 0_1ins276 |
| 4 | human | 401541 | CENPP | centromere protein P | XM_011518689.1 | 66.4% | 65.2% | (many diffs) |
| 5 | human | 401541 | CENPP | centromere protein P | XM_011518685.2 | 63.7% | 58.3% | (many diffs) |
| 6 | human | 401541 | CENPP | centromere protein P | NM_001286969.1 | 61.1% | 61.1% | 0_1ins336 |
| 7 | human | 401541 | CENPP | centromere protein P | NM_001286971.1 | 38.7% | 35% | (many diffs) |
| 8 | mouse | 66336 | Cenpp | centromere protein P | XM_006516942.1 | 43.3% | 38.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 930
- ORF length:
- 864
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cgcagagctg gcagaggtgc gcgccttgca agctgagatc gcggccctgc 121 ggcgagcgtg tgaggaccca ccggcgccct gggaagagaa gtcccgagtc caaaaatctt 181 ttcaagccat acaccaattc aatttggaag gatggaagtc ttcaaaagat ctgaaaaatc 241 agcttggaca tttagaatca gaactttcat ttctaagtac gcttactggc atcaatataa 301 gaaatcactc caagcagaca gaagacctaa caagcactga gatgacagaa aagagtatta 361 gaaaagttct acagagacac agattatcag gaaattgcca catggttaca tttcaacttg 421 aatttcagat tctggaaatt cagaataagg agagattatc ttctgctgtt actgacctca 481 acataataat ggagcccaca gaatgctcag aattaagtga atttgtgtct agagcagaag 541 agagaaaaga tctgttcatg tttttccgaa gccTGCATTT TTTTGTGGAG TGGTTTGAAT 601 ATCGTAAGCG CACGTTTAAA CATCTCAAGG AAAAGTACCC AGATGCCGTG TACCTCTCGG 661 AGGGGCCCTC CTCCTGCTCC ATGGGGATCC GCAGCGCCAG CCGGCCAGGG TTTGAATTAG 721 TCATTGTTTG GAGGATACAA ATAGATGAAG ATGGGAAGGT TTTTCCAAAG CTGGATCTTC 781 TCACCAAAGT CCCACAGCGA GCCCTGGAGC TGGACAAGAA CAGAGCCATA GAAACTGCTC 841 CTCTCAGCTT CCGAACCCTG GTAGGACTGC TTGGAATCGA AGCTGCTCTG GAAAGCCTGA 901 TAAAATCGCT TTGTGCAGAG GAGAACAACT ACCCAACTTT CTTGTACAAA GTGGTTGATA 961 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1021 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATAGAT 1081 CATCAGTTAT GACTCGTCAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1141 tgaaagatt