Transcript: Human NM_001286971.1

Homo sapiens centromere protein P (CENPP), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
CENPP (401541)
Length:
2570
CDS:
208..555

Additional Resources:

NCBI RefSeq record:
NM_001286971.1
NBCI Gene record:
CENPP (401541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428154 CATTGTTTGGAGGATACAAAT pLKO_005 345 CDS 100% 13.200 9.240 N CENPP n/a
2 TRCN0000172528 GAATCGAAGCTGCTCTGGAAA pLKO.1 497 CDS 100% 4.950 3.465 N CENPP n/a
3 TRCN0000168703 GCAAGGAATGAGGTCCTTTAT pLKO.1 1175 3UTR 100% 1.320 0.924 N CENPP n/a
4 TRCN0000172423 CGCAAGGAATGAGGTCCTTTA pLKO.1 1174 3UTR 100% 1.080 0.756 N CENPP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05649 pDONR223 100% 38.7% 35% None (many diffs) n/a
2 ccsbBroad304_05649 pLX_304 0% 38.7% 35% V5 (many diffs) n/a
3 TRCN0000466720 TAGATCATCAGTTATGACTCGTCA pLX_317 41.5% 38.7% 35% V5 (many diffs) n/a
Download CSV