Transcript: Human XM_011518685.2

PREDICTED: Homo sapiens centromere protein P (CENPP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CENPP (401541)
Length:
1648
CDS:
543..1217

Additional Resources:

NCBI RefSeq record:
XM_011518685.2
NBCI Gene record:
CENPP (401541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168413 GTACGCTTACTGGCATCAATA pLKO.1 754 CDS 100% 13.200 18.480 N CENPP n/a
2 TRCN0000422715 TGTTACTGACCTCAACATAAT pLKO_005 944 CDS 100% 13.200 9.240 N CENPP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05649 pDONR223 100% 63.7% 58.3% None (many diffs) n/a
2 ccsbBroad304_05649 pLX_304 0% 63.7% 58.3% V5 (many diffs) n/a
3 TRCN0000466720 TAGATCATCAGTTATGACTCGTCA pLX_317 41.5% 63.7% 58.3% V5 (many diffs) n/a
Download CSV