Construct: ORF TRCN0000466725
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016229.1_s317c1
- Derived from:
- ccsbBroadEn_04286
- DNA Barcode:
- TCCGCGATAAGGTCCGCCCATACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CD99L2 (83692)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466725
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 83692 | CD99L2 | CD99 molecule like 2 | NM_031462.4 | 100% | 100% | |
| 2 | human | 83692 | CD99L2 | CD99 molecule like 2 | NM_001242614.1 | 96.3% | 95.9% | 201_212del;668_685del |
| 3 | human | 83692 | CD99L2 | CD99 molecule like 2 | XM_017029890.2 | 87.2% | 81.2% | (many diffs) |
| 4 | human | 83692 | CD99L2 | CD99 molecule like 2 | NM_134446.4 | 81.2% | 81.2% | 130_131ins147 |
| 5 | human | 83692 | CD99L2 | CD99 molecule like 2 | NM_134445.4 | 72.5% | 72.1% | 130_131ins216 |
| 6 | human | 83692 | CD99L2 | CD99 molecule like 2 | NM_001184808.1 | 72.1% | 72.1% | 275_276ins219 |
| 7 | human | 83692 | CD99L2 | CD99 molecule like 2 | XM_017029891.2 | 69.6% | 63.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 852
- ORF length:
- 786
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt ggcctggcgc tcggcgttcc ttgtctgcct cgctttctcc ttggccaccc 121 tggtccagcg aggatctggg gactttgatg attttaacct ggaggatgca gtgaaagaaa 181 cttcctcagt aaagcagcca tgggaccaca ccaccaccac cacaaccaat aggccaggaa 241 ccaccagagc tccggcaaaa cctccaggta gtggattgga cttggctgat gctttggatg 301 atcaagatga tggccgcagg aaaccgggta taggaggaag agagagatgg aaccatgtaa 361 ccaccacgac caagaggcca gtaaccacca gagctccagc aaatacttta ggaaatgatt 421 ttgacttggc tgatgccctg gatgatcgaa atgatcgaga tgatggccgc aggaaaccaa 481 ttgctggagg aggaggtttt tcagacaagg aTCTTGAAGA CATAGTAGGG GGTGGAGAAT 541 ACAAACCTGA CAAGGGTAAA GGTGATGGCC GGTACGGCAG CAATGACGAC CCTGGATCTG 601 GCATGGTGGC AGAGCCTGGC ACCATTGCCG GGGTGGCCAG CGCCCTGGCC ATGGCCCTCA 661 TCGGTGCCGT CTCCAGCTAC ATCTCCTACC AGCAGAAGAA GTTCTGCTTC AGCATTCAGC 721 AGGGTCTCAA CGCAGACTAC GTGAAGGGAG AGAACCTGGA AGCCGTGGTA TGTGAGGAAC 781 CCCAAGTGAA ATACTCCACG TTGCACACGC AGTCTGCAGA GCCGCCGCCG CCGCCCGAAC 841 CAGCCCGGAT CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 901 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 961 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCC GCGATAAGGT CCGCCCATAC 1021 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t