Transcript: Human XM_017029890.2

PREDICTED: Homo sapiens CD99 molecule like 2 (CD99L2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD99L2 (83692)
Length:
1840
CDS:
77..880

Additional Resources:

NCBI RefSeq record:
XM_017029890.2
NBCI Gene record:
CD99L2 (83692)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029890.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147952 GATCGAAATGATCGAGATGAT pLKO.1 455 CDS 100% 4.950 6.930 N CD99L2 n/a
2 TRCN0000377751 ACAAACCTGACAAGGGTAAAG pLKO_005 552 CDS 100% 10.800 7.560 N CD99L2 n/a
3 TRCN0000147260 GATGCTTTGGATGATCAAGAT pLKO.1 299 CDS 100% 4.950 3.465 N CD99L2 n/a
4 TRCN0000149059 GCAGTGAAAGAAACTTCCTCA pLKO.1 179 CDS 100% 2.640 1.848 N CD99L2 n/a
5 TRCN0000371764 CACCAGAGCTCCAGCAAATAC pLKO_005 397 CDS 100% 13.200 7.920 N CD99L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029890.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04286 pDONR223 100% 87.2% 81.2% None (many diffs) n/a
2 ccsbBroad304_04286 pLX_304 0% 87.2% 81.2% V5 (many diffs) n/a
3 TRCN0000466725 TCCGCGATAAGGTCCGCCCATACC pLX_317 43.5% 87.2% 81.2% V5 (many diffs) n/a
Download CSV