Construct: ORF TRCN0000466782
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012940.1_s317c1
- Derived from:
- ccsbBroadEn_03884
- DNA Barcode:
- ACTGGGTCACAGTAGTGATTACCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TGIF2 (60436)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466782
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 60436 | TGIF2 | TGFB induced factor homeobox 2 | NM_001199513.1 | 100% | 100% | |
2 | human | 60436 | TGIF2 | TGFB induced factor homeobox 2 | NM_001199514.2 | 100% | 100% | |
3 | human | 60436 | TGIF2 | TGFB induced factor homeobox 2 | NM_001199515.1 | 100% | 100% | |
4 | human | 60436 | TGIF2 | TGFB induced factor homeobox 2 | NM_021809.7 | 100% | 100% | |
5 | mouse | 228839 | Tgif2 | TGFB-induced factor homeobox 2 | NM_173396.3 | 88.4% | 93.6% | (many diffs) |
6 | mouse | 228839 | Tgif2 | TGFB-induced factor homeobox 2 | XM_006499351.3 | 88.4% | 93.6% | (many diffs) |
7 | mouse | 228839 | Tgif2 | TGFB-induced factor homeobox 2 | XM_006499352.3 | 88.4% | 93.6% | (many diffs) |
8 | mouse | 228839 | Tgif2 | TGFB-induced factor homeobox 2 | XM_006499353.3 | 88.4% | 93.6% | (many diffs) |
9 | mouse | 228839 | Tgif2 | TGFB-induced factor homeobox 2 | XM_006499354.3 | 88.4% | 93.6% | (many diffs) |
10 | mouse | 228839 | Tgif2 | TGFB-induced factor homeobox 2 | NM_001291124.1 | 73.8% | 78% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 777
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggacagtgat ctaggtgagg acgaaggcct cctctccctg gcgggcaaaa 121 ggaagcgcag ggggaacctg cccaaggagt cggtgaagat cctccgggac tggctgtact 181 tgcaccgcta caacgcctac ccctcagagc aggagaagct gagcctttct ggacagacca 241 acctgtcagt gctgcaaata tgtaactggt tcatcaatgc ccggcggcgg cttctcccag 301 acatgcttcg gaaggatggc aaagacccta atcagtttac catttcccgc cgcgggggta 361 aggcctcaga tgtggccctc ccccgtggca gcagcccctc agtgctggct gtgtctgtcc 421 cagcccccac caatgtgctc tccctgtctg tgtgctccat gccgcttcac tcaggccagg 481 gggaaaagcc agcagcccct ttcccacgtg gggagctgga gtctcccaag cccctggtga 541 cccctggtag cacacttact cTGCTGACCA GGGCTGAGGC TGGAAGCCCC ACAGGTGGAC 601 TCTTCAACAC GCCACCACCC ACACCCCCAG AGCAGGACAA AGAGGACTTC AGCAGCTTCC 661 AGCTGCTGGT GGAGGTGGCG CTACAGAGGG CTGCTGAGAT GGAGCTTCAG AAGCAGCAGG 721 ACCCATCACT CCCATTACTG CACACTCCCA TCCCTTTAGT CTCTGAAAAT CCCCAGTACC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GAACTGGGTC ACAGTAGTGA TTACCCACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt