Transcript: Human NM_001199513.1

Homo sapiens TGFB induced factor homeobox 2 (TGIF2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
TGIF2 (60436)
Length:
3328
CDS:
87..800

Additional Resources:

NCBI RefSeq record:
NM_001199513.1
NBCI Gene record:
TGIF2 (60436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219518 AGGATGGCAAAGACCCTAATC pLKO.1 334 CDS 100% 10.800 7.560 N Tgif2-ps2 n/a
2 TRCN0000273613 CAGGACCCATCACTCCCATTA pLKO_005 738 CDS 100% 10.800 7.560 N TGIF2 n/a
3 TRCN0000018060 CCATCCCTTTAGTCTCTGAAA pLKO.1 769 CDS 100% 4.950 3.465 N TGIF2 n/a
4 TRCN0000273611 CCATCCCTTTAGTCTCTGAAA pLKO_005 769 CDS 100% 4.950 3.465 N TGIF2 n/a
5 TRCN0000018061 GACCCTAATCAGTTTACCATT pLKO.1 345 CDS 100% 4.950 3.465 N TGIF2 n/a
6 TRCN0000273612 GACCCTAATCAGTTTACCATT pLKO_005 345 CDS 100% 4.950 3.465 N TGIF2 n/a
7 TRCN0000018059 GCTGCAAATATGTAACTGGTT pLKO.1 272 CDS 100% 2.640 1.848 N TGIF2 n/a
8 TRCN0000335962 GTGGACATTCCAAGTTCATAT pLKO_005 1196 3UTR 100% 13.200 7.920 N TGIF2 n/a
9 TRCN0000219517 TATGTAACTGGTTCATCAATG pLKO.1 280 CDS 100% 10.800 6.480 N Tgif2-ps2 n/a
10 TRCN0000285029 GCTGTACTTGCACCGCTACAA pLKO_005 194 CDS 100% 4.950 2.475 Y TGIF2 n/a
11 TRCN0000018062 GCCCAAGGAGTCGGTGAAGAT pLKO.1 161 CDS 100% 1.650 0.825 Y TGIF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03884 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03884 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466782 ACTGGGTCACAGTAGTGATTACCC pLX_317 30.9% 100% 100% V5 n/a
Download CSV