Transcript: Mouse NM_001291124.1

Mus musculus TGFB-induced factor homeobox 2 (Tgif2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tgif2 (228839)
Length:
2783
CDS:
267..863

Additional Resources:

NCBI RefSeq record:
NM_001291124.1
NBCI Gene record:
Tgif2 (228839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095931 CCACGGGTGGACTCTTCAATA pLKO.1 673 CDS 100% 13.200 18.480 N LOC434518 n/a
2 TRCN0000219519 CACGGGTGGACTCTTCAATAC pLKO.1 674 CDS 100% 10.800 15.120 N Tgif2-ps2 n/a
3 TRCN0000348998 GTGTGCACATTCCAACCTATT pLKO_005 1216 3UTR 100% 10.800 15.120 N Tgif2 n/a
4 TRCN0000420028 ACGGGTGGACTCTTCAATACG pLKO_005 675 CDS 100% 4.950 6.930 N Tgif2 n/a
5 TRCN0000427590 GCTCTATCTGCACCGCTACAA pLKO_005 374 CDS 100% 4.950 3.960 N Tgif2 n/a
6 TRCN0000239884 CCTGCCCAAGGAGTCAGTAAA pLKO_005 338 CDS 100% 13.200 9.240 N Tgif2-ps1 n/a
7 TRCN0000219518 AGGATGGCAAAGACCCTAATC pLKO.1 514 CDS 100% 10.800 7.560 N Tgif2-ps2 n/a
8 TRCN0000243769 CCTTTCATGCAGAGGGTTATC pLKO_005 904 3UTR 100% 10.800 7.560 N Tgif2-ps2 n/a
9 TRCN0000243772 CTGCCCAAGGAGTCAGTAAAG pLKO_005 339 CDS 100% 10.800 7.560 N Tgif2-ps2 n/a
10 TRCN0000075523 CCCATCTTTATATCCTAAGAA pLKO.1 2017 3UTR 100% 5.625 3.938 N Tgif2 n/a
11 TRCN0000075527 GCCCAAGGAGTCAGTAAAGAT pLKO.1 341 CDS 100% 5.625 3.938 N Tgif2 n/a
12 TRCN0000301414 GCCCAAGGAGTCAGTAAAGAT pLKO_005 341 CDS 100% 5.625 3.938 N Tgif2 n/a
13 TRCN0000243768 AGCAGGACAAGGATGACTTCA pLKO_005 715 CDS 100% 4.950 3.465 N Tgif2-ps2 n/a
14 TRCN0000075524 GCAGATATGTAACTGGTTCAT pLKO.1 455 CDS 100% 4.950 3.465 N Tgif2 n/a
15 TRCN0000301415 GCAGATATGTAACTGGTTCAT pLKO_005 455 CDS 100% 4.950 3.465 N Tgif2 n/a
16 TRCN0000243771 TGCCGAGATGGAGCTTCAGAA pLKO_005 776 CDS 100% 4.950 3.465 N Tgif2-ps2 n/a
17 TRCN0000243770 GAGCAGGAGAAGCTAAGTCTC pLKO_005 408 CDS 100% 4.050 2.835 N Tgif2-ps2 n/a
18 TRCN0000095930 GCCCTTTCATGCAGAGGGTTA pLKO.1 902 3UTR 100% 4.050 2.835 N LOC434518 n/a
19 TRCN0000075526 GCTGCAGATATGTAACTGGTT pLKO.1 452 CDS 100% 2.640 1.848 N Tgif2 n/a
20 TRCN0000095932 GCTACACACTCCGCTGCCTTT pLKO.1 821 CDS 100% 1.350 0.945 N LOC434518 n/a
21 TRCN0000075525 GCGCCACCTTTGCTACACACT pLKO.1 810 CDS 100% 0.880 0.616 N Tgif2 n/a
22 TRCN0000301343 GCGCCACCTTTGCTACACACT pLKO_005 810 CDS 100% 0.880 0.616 N Tgif2 n/a
23 TRCN0000219517 TATGTAACTGGTTCATCAATG pLKO.1 460 CDS 100% 10.800 6.480 N Tgif2-ps2 n/a
24 TRCN0000095933 CAAGTACGGATCACTGCCAAA pLKO.1 925 3UTR 100% 4.050 5.670 N LOC434518 n/a
25 TRCN0000219516 TCTATCTGCACCGCTACAAAG pLKO.1 376 CDS 100% 10.800 7.560 N Tgif2-ps2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03884 pDONR223 100% 73.8% 78% None (many diffs) n/a
2 ccsbBroad304_03884 pLX_304 0% 73.8% 78% V5 (many diffs) n/a
3 TRCN0000466782 ACTGGGTCACAGTAGTGATTACCC pLX_317 30.9% 73.8% 78% V5 (many diffs) n/a
Download CSV