Construct: ORF TRCN0000466808
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010216.1_s317c1
- Derived from:
- ccsbBroadEn_01368
- DNA Barcode:
- GAGCTTCCAGTCTAGCTTCGTCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAD23A (5886)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466808
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5886 | RAD23A | RAD23 homolog A, nucleotide... | NM_005053.4 | 100% | 100% | |
| 2 | human | 5886 | RAD23A | RAD23 homolog A, nucleotide... | NM_001270362.1 | 99.7% | 99.7% | 674_675insAGC |
| 3 | human | 5886 | RAD23A | RAD23 homolog A, nucleotide... | XM_024451631.1 | 85.6% | 60% | 677_791del;1146_1147ins58 |
| 4 | human | 5886 | RAD23A | RAD23 homolog A, nucleotide... | NM_001270363.1 | 84.8% | 84.8% | 812_813ins165 |
| 5 | human | 5886 | RAD23A | RAD23 homolog A, nucleotide... | NR_072976.1 | 56.7% | 1_135del;550_551ins56;1169_1765del | |
| 6 | mouse | 19358 | Rad23a | RAD23 homolog A, nucleotide... | NM_001297606.1 | 89.2% | 94.7% | (many diffs) |
| 7 | mouse | 19358 | Rad23a | RAD23 homolog A, nucleotide... | NM_009010.5 | 88.9% | 94.4% | (many diffs) |
| 8 | mouse | 19358 | Rad23a | RAD23 homolog A, nucleotide... | XM_011248327.2 | 88.2% | 93.7% | (many diffs) |
| 9 | mouse | 19358 | Rad23a | RAD23 homolog A, nucleotide... | XM_011248328.2 | 88% | 93.4% | (many diffs) |
| 10 | mouse | 19358 | Rad23a | RAD23 homolog A, nucleotide... | NM_001297607.1 | 78.7% | 78% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1155
- ORF length:
- 1089
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgtcaccatc acgctcaaaa cgctgcagca gcagaccttc aagatccgca 121 tggagcctga cgagacggtg aaggtgctaa aggagaagat agaagctgag aagggtcgtg 181 atgccttccc cgtggctgga cagaaactca tctatgccgg caagatcttg agtgacgatg 241 tccctatcag ggactatcgc atcgatgaga agaactttgt ggtcgtcatg gtgaccaaga 301 ccaaagccgg ccagggtacc tcagcacccc cagaggcctc acccacagct gccccagagt 361 cctctacatc cttcccgcct gcccccacct caggcatgtc ccatccccca cctgccgcca 421 gagaggacaa gagcccatca gaggaatccg cccccacgac gtccccagag tctgtgtcag 481 gctctgttcc ctcttcaggt agcagcgggc gagaggaaga cgcggcctcc acgctagtga 541 cgggctctga gtatgagacg atgctgacgg agatcatgtc catgggctat gagcgagagc 601 gggtcgtggc cgccctgaga gccagctaca acaaccccca ccgagccgtg gagtatctgc 661 tcacgggaat tcctgggagc cccgagccgg aacacggttc tgtccaggag agccaggtat 721 cggagcagcc ggccacggaa gcagcaggag agaaccccct ggagttcctg cgggaccagc 781 ccCAGTTCCA GAACATGCGG CAGGTGATTC AGCAGAACCC TGCGCTGCTG CCCGCCCTGC 841 TCCAGCAGCT GGGCCAGGAG AACCCTCAGC TTTTACAGCA AATCAGCCGG CACCAGGAGC 901 AGTTCATCCA GATGCTGAAC GAGCCCCCTG GGGAGCTGGC GGACATCTCA GATGTGGAGG 961 GGGAGGTGGG CGCCATAGGA GAGGAGGCCC CGCAGATGAA CTACATCCAG GTGACGCCGC 1021 AGGAGAAAGA AGCTATAGAG AGGTTGAAGG CCCTGGGCTT CCCAGAGAGC CTGGTCATCC 1081 AGGCCTATTT CGCGTGTGAA AAAAATGAGA ACTTGGCTGC CAACTTCCTC CTGAGTCAGA 1141 ACTTTGATGA CGAGTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GAGCTTCCAG TCTAGCTTCG 1321 TCTGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt