Transcript: Mouse XM_011248328.2

PREDICTED: Mus musculus RAD23 homolog A, nucleotide excision repair protein (Rad23a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rad23a (19358)
Length:
1917
CDS:
183..1283

Additional Resources:

NCBI RefSeq record:
XM_011248328.2
NBCI Gene record:
Rad23a (19358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175305 CGATGTTCCCATCAAGGAATA pLKO.1 353 CDS 100% 10.800 7.560 N Rad23a n/a
2 TRCN0000314266 CGATGTTCCCATCAAGGAATA pLKO_005 353 CDS 100% 10.800 7.560 N Rad23a n/a
3 TRCN0000176426 CCCTAAGCTTTGATCCTCTAT pLKO.1 1700 3UTR 100% 4.950 3.465 N Rad23a n/a
4 TRCN0000314268 CCCTAAGCTTTGATCCTCTAT pLKO_005 1700 3UTR 100% 4.950 3.465 N Rad23a n/a
5 TRCN0000193497 GAAGAACTTTGTGGTTGTCAT pLKO.1 386 CDS 100% 4.950 3.465 N Rad23a n/a
6 TRCN0000314336 GAAGAACTTTGTGGTTGTCAT pLKO_005 386 CDS 100% 4.950 3.465 N Rad23a n/a
7 TRCN0000175719 GAATCCATTTCTGGCTCTGTT pLKO.1 585 CDS 100% 4.950 3.465 N Rad23a n/a
8 TRCN0000314337 GAATCCATTTCTGGCTCTGTT pLKO_005 585 CDS 100% 4.950 3.465 N Rad23a n/a
9 TRCN0000005974 GCAGACCTTCAAGATCCGCAT pLKO.1 218 CDS 100% 2.160 1.512 N RAD23A n/a
10 TRCN0000318462 GCAGACCTTCAAGATCCGCAT pLKO_005 218 CDS 100% 2.160 1.512 N RAD23A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01368 pDONR223 100% 88% 93.4% None (many diffs) n/a
2 ccsbBroad304_01368 pLX_304 0% 88% 93.4% V5 (many diffs) n/a
3 TRCN0000466808 GAGCTTCCAGTCTAGCTTCGTCTG pLX_317 34.5% 88% 93.4% V5 (many diffs) n/a
Download CSV