Transcript: Human NM_005053.4

Homo sapiens RAD23 homolog A, nucleotide excision repair protein (RAD23A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RAD23A (5886)
Length:
1772
CDS:
88..1179

Additional Resources:

NCBI RefSeq record:
NM_005053.4
NBCI Gene record:
RAD23A (5886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005974 GCAGACCTTCAAGATCCGCAT pLKO.1 123 CDS 100% 2.160 3.024 N RAD23A n/a
2 TRCN0000318462 GCAGACCTTCAAGATCCGCAT pLKO_005 123 CDS 100% 2.160 3.024 N RAD23A n/a
3 TRCN0000005973 GATGTCCCTATCAGGGACTAT pLKO.1 259 CDS 100% 0.495 0.693 N RAD23A n/a
4 TRCN0000005972 CCCTACCCTTATTCCATGAAA pLKO.1 1210 3UTR 100% 5.625 3.938 N RAD23A n/a
5 TRCN0000318421 CCCTACCCTTATTCCATGAAA pLKO_005 1210 3UTR 100% 5.625 3.938 N RAD23A n/a
6 TRCN0000005975 AGGCCTATTTCGCGTGTGAAA pLKO.1 1103 CDS 100% 4.950 3.465 N RAD23A n/a
7 TRCN0000318364 AGGCCTATTTCGCGTGTGAAA pLKO_005 1103 CDS 100% 4.950 3.465 N RAD23A n/a
8 TRCN0000005976 GAAGAACTTTGTGGTCGTCAT pLKO.1 291 CDS 100% 4.050 2.835 N RAD23A n/a
9 TRCN0000318420 GAAGAACTTTGTGGTCGTCAT pLKO_005 291 CDS 100% 4.050 2.835 N RAD23A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01368 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01368 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466808 GAGCTTCCAGTCTAGCTTCGTCTG pLX_317 34.5% 100% 100% V5 n/a
Download CSV