Construct: ORF TRCN0000466815
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011892.1_s317c1
- Derived from:
- ccsbBroadEn_07134
- DNA Barcode:
- AAAAACTCCAATTTCGTAGCAACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CORO2A (7464)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466815
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7464 | CORO2A | coronin 2A | NM_003389.3 | 99.8% | 99.8% | 525G>A;1504A>G |
| 2 | human | 7464 | CORO2A | coronin 2A | NM_052820.4 | 99.8% | 99.8% | 525G>A;1504A>G |
| 3 | human | 7464 | CORO2A | coronin 2A | XM_011518986.3 | 99.8% | 99.8% | 525G>A;1504A>G |
| 4 | mouse | 107684 | Coro2a | coronin, actin binding prot... | NM_001164804.1 | 85.3% | 85.7% | (many diffs) |
| 5 | mouse | 107684 | Coro2a | coronin, actin binding prot... | NM_178893.4 | 82.4% | 82.7% | (many diffs) |
| 6 | mouse | 107684 | Coro2a | coronin, actin binding prot... | XM_011249899.2 | 82.4% | 82.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1641
- ORF length:
- 1575
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc atggcacccc cagtaccgga gctccaagtt ccgtcatgtc tttggcaaac 121 cagccagcaa ggagaactgc tacgactccg tgcctatcac ccgcagcgtt cacgacaacc 181 acttctgtgc cgtgaacccc cacttcattg cagttgtgac tgagtgtgct ggtggagggg 241 ccttcctcgt catccccctg caccagacag ggaagttgga cccccactac ccaaaagtct 301 gcgggcacag aggcaacgtt ttggatgtca agtggaaccc ttttgatgat tttgagatcg 361 cctcctgttc tgaagatgcc acaattaaga tctggagcat ccccaagcag ctgctgacca 421 ggaacctcac ggcctacagg aaggaactcg tgggccacgc gcgcagagta ggcctggtgg 481 agtggcaccc cacggccgcc aacatcctct tcagtgctgg ctatgactac aaggtgatga 541 tctggaacct ggatacaaag gagtctgtca tcacaagccc catgagtaca attagctgtc 601 accaagatgt gatcctctcc atgtccttca acaccaacgg cagcctgttg gccaccacct 661 gcaaagaccg caagattcgg gttattgacc cccgagcagg gaccgtcctc caggaggcca 721 gctacaaagg gcaccgggcc agcaaagtgc tgtttctggg gaacctgaag aagctgatgt 781 ccacaggcac atcccgatgg aacaaccggc aggtggcctt gtgggaccag gataacctct 841 ctgtgcctct gatggaggag gacctggacg gctcctcggg cgtgctgttt cccttctatg 901 acgcggacac cagcatgctc tacgtggtgg ggaagggaga tggcaacatc cgctactacg 961 aggtgagcgc cgacaagcct cacctgagct acctgactga gtaccgctcc tataacccac 1021 agaaggggat cggtgtcatg ccaaagagag gactcgacgt gtcctcctgc gagatcttcc 1081 gcttctacaa gctgatcaca accaaaagcc tcatcgagcc catctccatg attgtgcccc 1141 ggcggtcaga atcctaccaa gaggacatat accctccaac agcaggggcc cagccctccc 1201 tgacggccca ggagtgGCTC AGCGGGATGA ATCGAGACCC AATCCTGGTG TCCCTTAGGC 1261 CTGGCTCTGA GCTGCTGAGA CCCCACCCAC TGCCTGCAGA GAGACCTATC TTCAATTCCA 1321 TGGCCCCAGC CTCACCCCGG CTCTTGAATC AGACAGAAAA GCTGGCTGCA GAAGATGGCT 1381 GGAGGTCTTC CTCCCTGTTG GAGGAGAAGA TGCCAAGGTG GGCAGCAGAA CACAGGCTGG 1441 AGGAGAAGAA AACCTGGCTG ACAAATGGCT TTGACGTTTT CGAATGCCCC CCACCAAAGA 1501 CAGAGAATGA GTTGCTGCAG ATGTTCTACC GGCAACAGGA GGAGATCCGA AGGCTCCGGG 1561 AGCTGTTGGC CCAGCGAGAG GTCCAGGCCA AACAGTTGGA ACTGGAGATC AAAAACTTGC 1621 GGATGGGCTC AGAGCAGCTC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1681 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1741 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAAAA ACTCCAATTT 1801 CGTAGCAACG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt