Transcript: Human XM_011518986.3

PREDICTED: Homo sapiens coronin 2A (CORO2A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CORO2A (7464)
Length:
2333
CDS:
444..2021

Additional Resources:

NCBI RefSeq record:
XM_011518986.3
NBCI Gene record:
CORO2A (7464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116906 GACCGCAAGATTCGGGTTATT pLKO.1 1044 CDS 100% 13.200 18.480 N CORO2A n/a
2 TRCN0000299168 GACCGCAAGATTCGGGTTATT pLKO_005 1044 CDS 100% 13.200 18.480 N CORO2A n/a
3 TRCN0000116904 GAGACCTATCTTCAATTCCAT pLKO.1 1679 CDS 100% 3.000 4.200 N CORO2A n/a
4 TRCN0000333690 GAGACCTATCTTCAATTCCAT pLKO_005 1679 CDS 100% 3.000 4.200 N CORO2A n/a
5 TRCN0000116902 GCCCATGATGAGCTGTAACTT pLKO.1 2271 3UTR 100% 5.625 3.938 N CORO2A n/a
6 TRCN0000299219 GCCCATGATGAGCTGTAACTT pLKO_005 2271 3UTR 100% 5.625 3.938 N CORO2A n/a
7 TRCN0000116905 CTATGACTACAAGGTGATGAT pLKO.1 899 CDS 100% 4.950 3.465 N CORO2A n/a
8 TRCN0000333623 CTATGACTACAAGGTGATGAT pLKO_005 899 CDS 100% 4.950 3.465 N CORO2A n/a
9 TRCN0000116903 CCTGTTCTGAAGATGCCACAA pLKO.1 742 CDS 100% 4.050 2.835 N CORO2A n/a
10 TRCN0000299169 CCTGTTCTGAAGATGCCACAA pLKO_005 742 CDS 100% 4.050 2.835 N CORO2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01776 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01776 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468923 TCCTGCTAGTTAATTTACTTTTAA pLX_317 24.8% 100% 100% V5 n/a
4 ccsbBroadEn_07134 pDONR223 100% 99.8% 99.8% None 525G>A;1504A>G n/a
5 ccsbBroad304_07134 pLX_304 0% 99.8% 99.8% V5 525G>A;1504A>G n/a
6 TRCN0000466815 AAAAACTCCAATTTCGTAGCAACG pLX_317 27.2% 99.8% 99.8% V5 525G>A;1504A>G n/a
Download CSV