Transcript: Mouse NM_001164804.1

Mus musculus coronin, actin binding protein 2A (Coro2a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Coro2a (107684)
Length:
3887
CDS:
114..1688

Additional Resources:

NCBI RefSeq record:
NM_001164804.1
NBCI Gene record:
Coro2a (107684)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364027 ACGGGAACATCCGCTACTATG pLKO_005 988 CDS 100% 10.800 15.120 N Coro2a n/a
2 TRCN0000090419 CCGCTACTATGAGGTAAGCAT pLKO.1 998 CDS 100% 3.000 4.200 N Coro2a n/a
3 TRCN0000375164 GATCCTCTCCATGTCCTTTAA pLKO_005 659 CDS 100% 13.200 9.240 N Coro2a n/a
4 TRCN0000375236 TCTGAAGATGCCACGATTAAG pLKO_005 417 CDS 100% 13.200 9.240 N Coro2a n/a
5 TRCN0000090421 GAGCTGTTAATCCAGAGAGAA pLKO.1 1605 CDS 100% 4.950 3.465 N Coro2a n/a
6 TRCN0000335547 GAGCTGTTAATCCAGAGAGAA pLKO_005 1605 CDS 100% 4.950 3.465 N Coro2a n/a
7 TRCN0000090418 GCCGAAATTCACTGAGAACAA pLKO.1 1807 3UTR 100% 4.950 3.465 N Coro2a n/a
8 TRCN0000335626 GCCGAAATTCACTGAGAACAA pLKO_005 1807 3UTR 100% 4.950 3.465 N Coro2a n/a
9 TRCN0000090422 GCTTCTATAAACTGATCACAA pLKO.1 1129 CDS 100% 4.950 3.465 N Coro2a n/a
10 TRCN0000090420 CCTTTCAATGACTTTGAGATT pLKO.1 387 CDS 100% 4.950 2.970 N Coro2a n/a
11 TRCN0000335546 CCTTTCAATGACTTTGAGATT pLKO_005 387 CDS 100% 4.950 2.970 N Coro2a n/a
12 TRCN0000116905 CTATGACTACAAGGTGATGAT pLKO.1 569 CDS 100% 4.950 3.465 N CORO2A n/a
13 TRCN0000333623 CTATGACTACAAGGTGATGAT pLKO_005 569 CDS 100% 4.950 3.465 N CORO2A n/a
14 TRCN0000116903 CCTGTTCTGAAGATGCCACAA pLKO.1 412 CDS 100% 4.050 2.835 N CORO2A n/a
15 TRCN0000299169 CCTGTTCTGAAGATGCCACAA pLKO_005 412 CDS 100% 4.050 2.835 N CORO2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01776 pDONR223 100% 85.3% 85.7% None (many diffs) n/a
2 ccsbBroad304_01776 pLX_304 0% 85.3% 85.7% V5 (many diffs) n/a
3 TRCN0000468923 TCCTGCTAGTTAATTTACTTTTAA pLX_317 24.8% 85.3% 85.7% V5 (many diffs) n/a
4 ccsbBroadEn_07134 pDONR223 100% 85.3% 85.7% None (many diffs) n/a
5 ccsbBroad304_07134 pLX_304 0% 85.3% 85.7% V5 (many diffs) n/a
6 TRCN0000466815 AAAAACTCCAATTTCGTAGCAACG pLX_317 27.2% 85.3% 85.7% V5 (many diffs) n/a
Download CSV