Construct: ORF TRCN0000466838
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007217.1_s317c1
- Derived from:
- ccsbBroadEn_11470
- DNA Barcode:
- GTCACAGCACGTCTCTGGGCGGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DDX39A (10212)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466838
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10212 | DDX39A | DExD-box helicase 39A | NM_005804.4 | 75.4% | 68% | 864_973del;1077_1281del |
| 2 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_011527620.1 | 75.4% | 68% | 864_973del;1077_1281del |
| 3 | human | 10212 | DDX39A | DExD-box helicase 39A | NR_046366.2 | 66.7% | 1_118del;1085_1448del | |
| 4 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_024451310.1 | 34.8% | 23.7% | (many diffs) |
| 5 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_006722606.4 | 27.4% | 21.2% | 0_1ins615;249_358del;462_666del |
| 6 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_011527621.3 | 27.4% | 21.2% | 0_1ins615;249_358del;462_666del |
| 7 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_024451311.1 | 27.4% | 21.2% | 0_1ins615;249_358del;462_666del |
| 8 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_024451312.1 | 27.4% | 21.2% | 0_1ins615;249_358del;462_666del |
| 9 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | NM_197982.3 | 67.4% | 65.9% | (many diffs) |
| 10 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_006531332.3 | 67.4% | 65.9% | (many diffs) |
| 11 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017312949.1 | 62.8% | 61.6% | (many diffs) |
| 12 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017312950.1 | 62.8% | 61.6% | (many diffs) |
| 13 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017312952.1 | 25.6% | 21.2% | (many diffs) |
| 14 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017312951.1 | 23.9% | 19.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1032
- ORF length:
- 966
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agaacaggat gtggaaaacg atcttttgga ttacgatgaa gaggaagagc 121 cccaggctcc tcaagagagc acaccagctc cccctaagaa agacatcaag ggatcctacg 181 tttccatcca cagctctggc ttccgggact ttctgctgaa gccggagctc ctgcgggcca 241 tcgtggactg tggctttgag catccttctg aggtccagca tgagtgcatt ccccaggcca 301 tcctgggcat ggacgtcctg tgccaggcca agtccgggat gggcaagaca gcggtcttcg 361 tgctggccac cctacagcag attgagcctg tcaacggaca ggtgacggtc ctggtcatgt 421 gccacacgag ggagctggcc ttccagatca gcaaggaata tgagcgcttt tccaagtaca 481 tgcccagcgt caaggtgtct gtgttcttcg gtggtctctc catcaagaag gatgaagaag 541 tgttgaagaa gaactgtccc catgtcgtgg tggggacccc gggccgcatc ctggcgctcg 601 tgcggaatag gagcttcagc ctaaagaatg tgaagcactt tgtgctggac gagtgtgaca 661 agatgctgga gcagctggac atgcggcggg atgtgcagga gaTCTTCCGC CTGACACCAC 721 ACGAGAAGCA GTGCATGATG TTCAGCGCCA CCCTGAGCAA GGACATCCGG CCTGTGTGCA 781 GGAAGTTCAT GCAGGATCCC ATGGAGGTGT TTGTGGACGA CGAGACCAAG CTCACGCTGC 841 ACGGCCTGCA GCAGTACTAC GTCAAACTCA AAGACAGTGA GAAGAACCGC AAGCTCTTTG 901 ATCTCTTGGA TGTGCTGGAG TTTAACCAGC CTGTCACGCT ATCAGCAGTT CAAGGATTTC 961 CAGCGGCGGA TCCTGGTGGC CACCAATCTG TTTGGCCGGG GGATGGACAT CGAGCGAGTC 1021 AACATCGTCT TTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1141 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGTC ACAGCACGTC TCTGGGCGGC 1201 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t