Transcript: Human NR_046366.2

Homo sapiens DExD-box helicase 39A (DDX39A), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-03-20
Taxon:
Homo sapiens (human)
Gene:
DDX39A (10212)
Length:
1448
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046366.2
NBCI Gene record:
DDX39A (10212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344713 GAATAGGAGCTTCAGCCTAAA pLKO_005 658 3UTR 100% 10.800 15.120 N DDX39A n/a
2 TRCN0000050668 GCGAGTCAACATCGTCTTTAA pLKO.1 1067 3UTR 100% 13.200 9.240 N DDX39A n/a
3 TRCN0000333248 GCGAGTCAACATCGTCTTTAA pLKO_005 1067 3UTR 100% 13.200 9.240 N DDX39A n/a
4 TRCN0000050670 CCTAAAGAATGTGAAGCACTT pLKO.1 673 3UTR 100% 4.050 2.835 N DDX39A n/a
5 TRCN0000050672 GAAGTTAATGTGGCAGAACTT pLKO.1 1227 3UTR 100% 0.495 0.347 N DDX39A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02356 pDONR223 100% 75.1% None 1_118del;981_982ins110;1290_1448del n/a
2 ccsbBroad304_02356 pLX_304 0% 75.1% V5 1_118del;981_982ins110;1290_1448del n/a
3 TRCN0000470322 TTAATGTTGTCGGCCGCCTCAATT pLX_317 28.9% 75.1% V5 1_118del;981_982ins110;1290_1448del n/a
4 ccsbBroadEn_11470 pDONR223 100% 66.7% None 1_118del;1085_1448del n/a
5 ccsbBroad304_11470 pLX_304 0% 66.7% V5 1_118del;1085_1448del n/a
6 TRCN0000466838 GTCACAGCACGTCTCTGGGCGGCA pLX_317 34.4% 66.7% V5 1_118del;1085_1448del n/a
7 ccsbBroadEn_11471 pDONR223 100% 61.9% None (many diffs) n/a
8 ccsbBroad304_11471 pLX_304 0% 61.9% V5 (many diffs) n/a
9 TRCN0000469434 GTTTCGAAGAAGGCTGTTATGCAT pLX_317 41.6% 61.9% V5 (many diffs) n/a
Download CSV