Transcript: Human NM_005804.4

Homo sapiens DExD-box helicase 39A (DDX39A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DDX39A (10212)
Length:
1498
CDS:
77..1360

Additional Resources:

NCBI RefSeq record:
NM_005804.4
NBCI Gene record:
DDX39A (10212)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005804.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344713 GAATAGGAGCTTCAGCCTAAA pLKO_005 616 CDS 100% 10.800 15.120 N DDX39A n/a
2 TRCN0000050671 CCAGGTGATAATCTTCGTCAA pLKO.1 937 CDS 100% 4.050 3.240 N DDX39A n/a
3 TRCN0000333247 CCAGGTGATAATCTTCGTCAA pLKO_005 937 CDS 100% 4.050 3.240 N DDX39A n/a
4 TRCN0000050669 GCTGGAGTTTAACCAGGTGAT pLKO.1 925 CDS 100% 4.050 3.240 N DDX39A n/a
5 TRCN0000333165 GCTGGAGTTTAACCAGGTGAT pLKO_005 925 CDS 100% 4.050 3.240 N DDX39A n/a
6 TRCN0000050668 GCGAGTCAACATCGTCTTTAA pLKO.1 1135 CDS 100% 13.200 9.240 N DDX39A n/a
7 TRCN0000333248 GCGAGTCAACATCGTCTTTAA pLKO_005 1135 CDS 100% 13.200 9.240 N DDX39A n/a
8 TRCN0000050670 CCTAAAGAATGTGAAGCACTT pLKO.1 631 CDS 100% 4.050 2.835 N DDX39A n/a
9 TRCN0000050672 GAAGTTAATGTGGCAGAACTT pLKO.1 1295 CDS 100% 0.495 0.347 N DDX39A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005804.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02356 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02356 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470322 TTAATGTTGTCGGCCGCCTCAATT pLX_317 28.9% 100% 100% V5 n/a
4 ccsbBroadEn_07187 pDONR223 100% 78.5% 89.7% None (many diffs) n/a
5 ccsbBroad304_07187 pLX_304 0% 78.5% 89.7% V5 (many diffs) n/a
6 TRCN0000471716 TTGTCGAATTCGCCTCTGGCGCAG pLX_317 31.2% 78.5% 89.7% V5 (many diffs) n/a
7 ccsbBroadEn_11470 pDONR223 100% 75.4% 68% None 864_973del;1077_1281del n/a
8 ccsbBroad304_11470 pLX_304 0% 75.4% 68% V5 864_973del;1077_1281del n/a
9 TRCN0000466838 GTCACAGCACGTCTCTGGGCGGCA pLX_317 34.4% 75.4% 68% V5 864_973del;1077_1281del n/a
10 ccsbBroadEn_11471 pDONR223 100% 68.8% 55.9% None (many diffs) n/a
11 ccsbBroad304_11471 pLX_304 0% 68.8% 55.9% V5 (many diffs) n/a
12 TRCN0000469434 GTTTCGAAGAAGGCTGTTATGCAT pLX_317 41.6% 68.8% 55.9% V5 (many diffs) n/a
Download CSV